Рубрика

Процесс самоудвоения днк: Репликация ДНК — урок. Биология, Общие биологические закономерности (9–11 класс).

Содержание

Можете ли простыми словами объяснить процесс самоудвоения молекул ДНК?

Могу. Вопрос насколько простыми

ДНК состоит из двух цепей, соединенных между собой достаточно слабой связью (водородные мостики), скрученных в спираль. Каждая цепь это последовательность особых сложных веществ называемых нуклеотидами, основная часть которых - азотистое основание. В составе ДНК их четыре вида: А (аденин), Т (тимин), Г (гуанин), Ц (цитозин). Нуклеотиды в противоположных цепях ДНК располагаются не как попало, а согласно определенному принципу (комплементарности): "А" соединяется с "Т", "Г" соединяется с "Ц". По сути, какую либо генетическую информацию несет лишь одна цепь, а вторая нужна, чтобы в случае чего починить первую (по принципу комплементарности)

Теперь про самоудвоение. Научное название этого процесса - репликация, в результате которой образуются две молекулы ДНК, но в каждой новой ДНК присутствует одна старая материнская цепь (полуконсервативный механизм).

Стоит заметить что у безъядерных организмов (прокариот) и имеющих ядро (эукариот) этот процесс протекает подобным образом, но при участии различных ферментов. На всякий скажу, что фермент - это белковая молекула, выполняющая определенную специфическую биохимическую функцию. 

Итак, вначале необходимо раскрутить спираль, для этого есть специальный фермент (топоизомераза), она двигается вдоль цепей ДНК выпрямляя их за собой, но при этом сильнее закручивая перед собой, когда степень закручивания достигает определенного критического уровня, топоизомераза разрезает одну из цепей и за счет раскрутки снижает напряжение, после заново сшивает и едет дальше. В комплексе с ней действует второй фермент (хеликаза), который разрушает водородные связи между цепями выпрямленной ДНК, после чего они расходятся в разные стороны.

Далее процесс происходит с отличиями: есть лидирующая цепь и отстающая.
На лидирующей цепи в направлении расплетения происходит присоединение нуклеотидов ферментом ДНК-полимеразой 3 по принципу комплементарности - одна молекула ДНК готова.

На отстающей цепи все сложнее. У ДНК-полимераз есть две неприятных особенности: первая - они способны перемещаться вдоль цепей ДНК только в определенном направлении, и если на лидирующей цепи это движение было в сторону расплетения, то на отстающей оно обязательно в противоположную; вторая - для начала работы ей нужно куда то прицепиться (по научному к затравке). Роль затравки тут выполняют короткие молекулы РНК, синтезируемые РНК-полимеразой так же по принципу комплементарности к цепи ДНК (этому ферменту затравка не нужна), их синтезируется большое количество и они во многих местах цепляются к отстающей цепи. Далее к ним подходит ДНК-полимераза 3 и заполняет промежутки между ними. Такой участок РНК + ДНК называется фрагментом Оказаки. Следующий этап это удаление РНК последовательностей из отстающей цепи ДНК: с этим успешно справляется ДНК-полимераза 1, которая  заменяет одни нуклеотиды на другие (у ДНК и РНК они отличаются по химической структуре). После этого разъедененные участки сшиваются ферментом лигазой - вторая молекула ДНК готова.

Далее цепи расходятся, спирализуются и готовы выполнять свои важные биологические функции.

Можете ли простыми словами объяснить процесс самоудвоения молекул ДНК?

Могу. Вопрос насколько простыми

ДНК состоит из двух цепей, соединенных между собой достаточно слабой связью (водородные мостики), скрученных в спираль. Каждая цепь это последовательность особых сложных веществ называемых нуклеотидами, основная часть которых - азотистое основание. В составе ДНК их четыре вида: А (аденин), Т (тимин), Г (гуанин), Ц (цитозин). Нуклеотиды в противоположных цепях ДНК располагаются не как попало, а согласно определенному принципу (комплементарности): "А" соединяется с "Т", "Г" соединяется с "Ц". По сути, какую либо генетическую информацию несет лишь одна цепь, а вторая нужна, чтобы в случае чего починить первую (по принципу комплементарности)

Теперь про самоудвоение. Научное название этого процесса - репликация, в результате которой образуются две молекулы ДНК, но в каждой новой ДНК присутствует одна старая материнская цепь (полуконсервативный механизм).

Стоит заметить что у безъядерных организмов (прокариот) и имеющих ядро (эукариот) этот процесс протекает подобным образом, но при участии различных ферментов. На всякий скажу, что фермент - это белковая молекула, выполняющая определенную специфическую биохимическую функцию.

Итак, вначале необходимо раскрутить спираль, для этого есть специальный фермент (топоизомераза), она двигается вдоль цепей ДНК выпрямляя их за собой, но при этом сильнее закручивая перед собой, когда степень закручивания достигает определенного критического уровня, топоизомераза разрезает одну из цепей и за счет раскрутки снижает напряжение, после заново сшивает и едет дальше. В комплексе с ней действует второй фермент (хеликаза), который разрушает водородные связи между цепями выпрямленной ДНК, после чего они расходятся в разные стороны. Далее процесс происходит с отличиями: есть лидирующая цепь и отстающая. На лидирующей цепи в направлении расплетения происходит присоединение нуклеотидов ферментом ДНК-полимеразой 3 по принципу комплементарности - одна молекула ДНК готова.

На отстающей цепи все сложнее. У ДНК-полимераз есть две неприятных особенности: первая - они способны перемещаться вдоль цепей ДНК только в определенном направлении, и если на лидирующей цепи это движение было в сторону расплетения, то на отстающей оно обязательно в противоположную; вторая - для начала работы ей нужно куда то прицепиться (по научному к затравке). Роль затравки тут выполняют короткие молекулы РНК, синтезируемые РНК-полимеразой так же по принципу комплементарности к цепи ДНК (этому ферменту затравка не нужна), их синтезируется большое количество и они во многих местах цепляются к отстающей цепи. Далее к ним подходит ДНК-полимераза 3 и заполняет промежутки между ними. Такой участок РНК + ДНК называется фрагментом Оказаки. Следующий этап это удаление РНК последовательностей из отстающей цепи ДНК: с этим успешно справляется ДНК-полимераза 1, которая заменяет одни нуклеотиды на другие (у ДНК и РНК они отличаются по химической структуре). После этого разъедененные участки сшиваются ферментом лигазой - вторая молекула ДНК готова. Далее цепи расходятся, спирализуются и готовы выполнять свои важные биологические функции.

Что такое репликация молекул ДНК и как она осуществляется - Клетка - структурная и функциональная единица жизни

Репликация — это процесс самоудвоения молекул ДНК при участии ферментов. Репликация осуществляется перед каждым клеточным делением. Она начинается с раскручивания спирали ДНК в S-периоде интерфазы под действием фермента ДНК-полимеразы. На каждой из цепей, образовавшихся после разрыва водородных связей, синтезируется по принципу комплементарности и антипараллельности дочерняя цепь ДНК. Причем одна из новых цепей синтезируется сплошной, а вторая — в виде коротких фрагментов, которые затем сшиваются специальным ферментом — ДНК-лигазой.

Таким образом, каждая полинуклеотидная цепь выполняет роль матрицы для новой комплементарной цепи. В каждой из 2-х молекул ДНК одна цепь остается от родительской молекулы, а другая является вновь синтезированной. Такой принцип репликации назван полуконсервативным.

Биологический смысл репликации заключается в точной передаче наследственной информации от материнской клетки к дочерним, что и происходит при делении соматических клеток.

Самая важная особенность репликации ДНК — ее высокая точность.

Если при репликации ДНК последовательность нуклеотидов в ее молекуле нарушается в силу каких-либо причин, то в большинстве случаев эти повреждения устраняются клеткой самостоятельно. Исправление нарушений последовательности нуклеотидов в молекуле ДНК называется репарацией. Изменение происходит обычно в одной из цепей ДНК. Вторая цепь остается неизмененной. Поврежденный участок первой цепи вырезается с помощью ферментов — ДНК-репарирующих нуклеаз. Другой фермент — ДНК-полимераза — копирует информацию с неповрежденной цепи, вставляя необходимые нуклеотиды в поврежденную цепь. Затем ДНК-лигаза сшивает вставленный участок с цепью ДНК. В итоге поврежденная молекула восстанавливается.

Однако бывают случаи, когда пропускается несколько нуклеотидов, или вставляется несколько лишних, или один нуклеотид вставляется вместо другого, например, Ц вместо Т или А вместо Г. Такие изменения последовательности нуклеотидов в молекуле ДНК являются мутациями. Их воспроизведение в последующих поколениях клеток может приводить к патологии.

Самоудвоение ДНК. Образование двухроматидных хромосом.(РЕПЛИКАЦИЯ) — Студопедия

Реплика́ция ДНК — процесс синтеза дочерней молекулы ДНК на матрице родительской молекулы ДНК. В ходе последующего деления материнской клетки каждая дочерняя клетка получает по одной копии молекулы ДНК, которая является идентичной ДНК исходной материнской клетки. Этот процесс обеспечивает точную передачу генетической информации из поколения в поколение. Репликацию ДНК осуществляет сложный ферментный комплекс, состоящий из 15—20 различных белков, называемый реплисомой

Репликация ДНК — ключевое событие в ходе деления клетки. Принципиально, чтобы к моменту деления ДНК была реплицирована полностью и при этом только один раз. Это обеспечивается определёнными механизмами регуляции репликации ДНК. Репликация проходит в три этапа:

1. инициация репликации

2. элонгация

3. терминация репликации.

Регуляция репликации осуществляется в основном на этапе инициации. Это достаточно легко осуществимо, потому что репликация может начинаться не с любого участка ДНК, а со строго определённого, называемого сайтом инициации репликации. В генометаких сайтов может быть как всего один, так и много. С понятием сайта инициации репликации тесно связано понятие репликон. Репликон — это участок ДНК, который содержит сайт инициации репликации и реплицируется после начала синтеза ДНК с этого сайта. Геномы бактерий, как правило, представляют собой один репликон, это значит, что репликация всего генома является следствием всего одного акта инициации репликации. Геномы эукариот (а также их отдельные хромосомы) состоят из большого числа самостоятельных репликонов, это значительно сокращает суммарное время репликации отдельной хромосомы. Молекулярные механизмы, которые контролируют количество актов инициации репликации в каждом сайте за один цикл деления клетки, называются контролем копийности. В бактериальных клетках помимо хромосомной ДНК часто содержатся плазмиды, которые представляют собой отдельные репликоны. У плазмид существуют свои механизмы контроля копийности: они могут обеспечивать синтез как всего одной копии плазмиды за клеточный цикл, так и тысяч копий

[1].


Репликация начинается в сайте инициации репликации с расплетания двойной спирали ДНК, при этом формируется репликационная вилка — место непосредственной репликации ДНК. В каждом сайте может формироваться одна или две репликационные вилки в зависимости от того, является ли репликация одно- или двунаправленной. Более распространена двунаправленная репликация. Через некоторое время после начала репликации в электронный микроскоп можно наблюдатьрепликационный глазок — участок хромосомы, где ДНК уже реплицирована, окруженный более протяженными участками нереплицированной ДНК[1].


В репликационной вилке ДНК копирует крупный белковый комплекс (реплисома), ключевым ферментом которого является ДНК-полимераза. Репликационная вилка движется со скоростью порядка 100 000 пар нуклеотидов в минуту у прокариот и 500—5000 — у эукарио

Молекулярный механизм репликации

Ферменты (хеликаза, топоизомераза) и ДНК-связывающие белки расплетают ДНК, удерживают матрицу в разведённом состоянии и вращают молекулу ДНК. Правильность репликации обеспечивается точным соответствием комплементарных пар оснований и активностью ДНК-полимеразы, способной распознать и исправить ошибку. Репликация у эукариот осуществляется несколькими разными ДНК-полимеразами. Далее происходит закручивание синтезированных молекул по принципусуперспирализации и дальнейшей компактизации ДНК. Синтез энергозатратный.

Цепи молекулы ДНК расходятся, образуют репликационную вилку, и каждая из них становится матрицей, на которой синтезируется новая комплементарная цепь. В результате образуются две новые двуспиральные молекулы ДНК, идентичные родительской молекуле.

Образование двухроматидных хромасом происходит в анафазе

Механизм репликации смотреть в 37

Удвоение нитей днк происходит в. Можете ли простыми словами объяснить процесс самоудвоения молекул ДНК? Глава IV. Наследственная информация и реализация ее в клетке

В репликации (слово "реплика" означает "отпечаток, копия") участвуют 5 различных белков (рис. 40). Все вместе они образуют так называемую репликативную вилку . Репликативная вилка постепенно ползет вдоль молекулы ДНК, оставляя позади две новые молекулы ДНК. Первой движется

хеликаза . Она разъединяет две нуклеотидные цепочки ДНК. На образовавшиеся одноцепочечные участки немедленно налипают стабилизирующие белки . Стабилизирующие белки не дают двум комплементарным друг другу цепочкам ДНК вновь соединиться позади хеликазы. Следом за хеликазой по одной из цепей (она называется лидирующая цепь) ползет ДНК-полимераза в направлении к 5"-концу. Она синтезирует новую цепочку нуклеотидов ДНК, комплементарную лидирующей цепи, присоединяя нуклеотиды ДНК к 3"-концу. По второй цепи ДНК (отстающая цепь) ДНК-полимераза ползет в противоположном направлении (тоже в направлении к 5"-концу). Но при этом получается, что отстающая цепь изготавливается "по кусочкам": ДНК-полимераза всякий раз ползет от хеликазы назад, к началу предыдущего кусочка, и отделяется от ДНК, оставив "дырку" (всего одну разомкнутую связь между соседними нуклеотидами) между концом только что изготовленного кусочка и началом предыдущего. Эту недостающую связь образует специальный белок ДНК-лигаза .

! Присоединение нового нуклеотида к молекуле РНК или ДНК (полимеразная реакция).

Рис. 41. Полимеразная реакция

На рис. 41 показано, как это делается. Обратите внимание: в качестве "сырья" для изготовления нуклеиновых кислот используются не просто мономеры - нуклеотиды, а нуклеозидтрифосфаты . Эти молекулы похожи на нуклеотиды, но, в отличие от них, содержат не один, а целых три остатка фосфорной кислоты. В результате каждой реакции присоединения нового нуклеотида (всегда к 3"-концу!) "растущей" молекулы РНК или ДНК два фосфата отделяются.

Глава 6. Цитоскелет.

Любой из нас имеет скелет. Он состоит из твердых костей, гибких связок, соединяющих кости между собой, и мягких мышц, которые прикреплены к костям и, с силой меняя форму, изменяют взаимное расположение разных костей и мягких тканей тела относительно костей. В клетке имеются специальные белки, играющие роль костей и мышц. Всю систему таких белков называют цитоскелетом .

Микротрубочки

Микротрубочки (рис. 42) полностью соответствуют своему названию. Это прямые микроскопические трубочки (наружный диаметр 28 нм, внутренний - 14 нм), состоящие из двух похожих друг на друга белков a-тубулина (a - греческая буква альфа, все слово читается "альфа-тубулин") и в-тубулина ("бета-тубулин"). Два конца микротрубочки отличаются друг от друга некоторыми важными свойствами (их называют "+" и "-"-концы ). В ДНК клетки имеются два разных гена, содержащие информацию о последовательностях аминокислот а-тубулина и в-тубулина. После синтеза на рибосомах в цитоплазме молекулы а- и в-тубулина объединяются в димеры ("ди" - "два", "мерос" - "часть"). Димеры тубулина при определенных условиях могут присоединяться к "+"-концу микротрубочки, микротрубочка при этом удлиняется. С "-"-конца микротрубочки могут разбираться (то есть от него отделяются димеры тубулина, и микротрубочка при этом укорачивается). Изменяя условия в разных частях цитоплазмы, клетка имеет возможность делать сеть микротрубочек в ней более или, наоборот, менее густой. Кроме того, есть белки, способные присоединяться к "+"-концам микротрубочек, прекращая тем самым их сборку, и другие белки, способные присоединяться к "-"-концам и прекращать разборку микротрубочек (вместе они называются “кэпирующие белки ”).

Известны специальные транспортные белки, способные перетаскивать по микротрубочкам различные органоиды клетки. Один из них, кинезин , переносит их в направлении от "-"- к "+"-концу.

! Механизм образования пищеварительной вакуоли при фагоцитозе

В большинстве клеток работают два независимых механизма.

Первый из них - простое следствие механизма прилипания пищевой частицы к мембране. За счет теплового движения молекул воды и пищевая частица, и рецепторы мембраны все время слегка вибрируют. Поэтому близко расположенные, но еще не соединившиеся друг с другом рецепторы и лиганды через короткое время сталкиваются и слипаются. Получается, что мембрана все больше и больше налипает на пищевую частицу со всех сторон (рис. 14а), 1-4).

Второй механизм обеспечивается работой специальных белков, одним концом присоединяющихся к рецепторам мембраны, уже прилипшим к лигандам на пищевой частице, а другим - к расположенным под мембраной микротрубочкам. Эти белки способны двигаться по микротрубочкам вглубь цитоплазмы, "волоча за собой" рецепторы, закрепленные в мембране. В результате работы многих таких белков весь кусок мембраны, прилипший к пищевой частице, погружается внутрь клетки, "на ходу" замыкаясь в пузырек (рис. 14б), 5).

Актомиозин.

Актомиозин - комплекс из молекул 4-х разных белков (а именно актина, тропонина, тропомиозина имиозина ) в виде нитей в цитоплазме, способных с силой укорачиваться.

В результате синтеза белка на актиновой иРНК от рибосом отделяются молекулы G-актина (рис. 43а)). В цитоплазме они слипаются друг с другом в нити F-актина . Молекулы тропомиозина тоже сначала слипаются друг с другом в нити, а затем такие нити присоединяются к двум желобкам каждой нити F-актина. На нить F-актина садятся также молекулы тропонина (рис. 43б)). Молекула тропонина состоит из трех субъединиц. Одна из них способна присоединяться к F-актину, вторая - к тропомиозину, а третья соединяет первые две, прикрепляясь одним концом к первой, а другим - ко второй. Нить, состоящую из этих трех белков, называют актиновым филаментом, илимикрофиламентом . При появлении в растворе ионов кальция третья субъединица тропонина удлиняется, извлекая нити тропомиозина из желобков F-актина (рис. 43в)), при исчезновении кальция из раствора эта субъединица укорачивается, возвращая нити тропомиозина обратно в желобки.

Рис. 44 Рис. 45

Молекула миозина состоит из двух "головок" и "хвоста". Такие молекулы в цитоплазме могут слипаться друг с другом, образуя нити миозина (рис. 44. "Головки" молекул миозина образуют на поверхности нити миозина шесть продольных рядов. Отдельная молекула миозина в присутствии ионов кальция и АТФ перемещается по микрофиламенту в направлении от своего "хвоста"”, цепляясь “головками” за желобки F-актина. Нить миозина может присоединить максимум 12 актиновых филаментов (по 6 с каждого конца), и затем в присутствии ионов кальция и АТФ (подробно про ионы кальция рассказано в главе 7, а про АТФ - в главе 9) "тащить" их друг к другу до соприкосновения (рис. 45а)). Выяснилось, что в некоторых клетках миозин образует димеры (рис. 45б)). Димер миозина может перемещать один микрофиламент по другому.

Клеточный цикл. Митоз.

Доказано, что новые живые клетки могут возникать одним-единственным способом - в результате деления клеток. В ядре каждой клетки имеются молекулы ДНК, содержащие информацию об аминокислотном составе всех ее белков. Обе клетки, возникающие в результате деления, должны получить полноценные копии всех молекул ДНК материнской клетки. Для этого все молекулы ДНК материнской клетки должны быть сначала удвоены (период в жизни клетки, когда в ней происходит удвоение (репликация ) ДНК, называется S-фазой клеточного цикла ), а во время деления клетки - распределены по обеим дочерним клеткам.

Рис. 46

Клеточный цикл - это последовательность событий, связанных с размножением клетки (рис. 46). Он состоит из собственно деления клетки (митоза ), паузы до начала удвоения ДНК (G1-фаза ), удвоения ДНК (S-фаза ) и паузы от момента окончания S-фазы до начала митоза (G2-фазы ). G1-, S- и G2-фазы вместе называются интерфазой .

Молекулы ДНК в G2-фазе перед началом митоза подвергаются тщательной упаковке с помощью специальных белков (рис. 47). Результат этой упаковки - митотическая хромосома . Перед началом митоза внутри ядра под микроскопом становятся видны хромосомы (упакованные молекулы ДНК, соединенные попарно центромерами с помощью специальных белковых “замков” - кинетохоров ). Каждая такая пара молекул ДНК - "сестры", получившиеся при удвоении одной молекулы ДНК клетки. При митозе им предстоит разойтись по разным дочерним клеткам.

Сам митоз состоит из четырех фаз: профазы, метафазы, анафазы и телофазы .

В профазе (рис. 48, 1) происходит удвоение центриолей (каждая из двух центриолей материнской клетки строит около себя дочернюю центриоль) и две пары центриолей расходятся в разные концы (принято говорить: на разные полюса) делящейся клетки. После этого около каждой пары центриолей начинается сборка микротрубочек (при этом их "+"-концы обращены от центриолей в цитоплазму). В результате образуется веретено деления , состоящее из двух половинок (полуверетен ) с парой центриолей в вершине каждой из них. В конце профазы оболочка ядра распадается на мелкие мембранные пузырьки (в конце митоза из них будут собраны два новых ядра), и хромосомы оказываются в цитоплазме.

В метафазе (рис. 48, 2-3) "+"-концы микротрубочек прикрепляются к кинетохорам хромосом. Первый из этих "+"-концов может прикрепиться к кинетохору с любой стороны. Далее возможны два варианта развития событий. Если "+"-конец второй микротрубочки прикрепится к кинетохору с той же стороны, что и первый, то в следующий момент кинетохор отделяется от обеих микротрубочек, и все начинается сначала. Если же "+"-конец второй микротрубочки прикрепится к кинетохору со стороны другого полюса клетки, то кинетохор прочно прикрепляется к обеим микротрубочкам. Что происходит дальше, не вполне понятно. Почему-то сборка и разборка прикрепившихся к кинетохорам хромосом микротрубочек происходят так, что все хромосомы выстраиваются в плоскости экватора делящейся клетки. Известно, что если с помощью тонкой стеклянной иглы помешать одной хромосоме добраться до этой плоскости, митоз приостановится до тех пор, пока эта хромосома не займет свое место.

Рис. 49

Когда все хромосомы выстраиваются в экваториальной плоскости, специальные белки разрезают кинетохоры пополам, так, что "сестринские" молекулы ДНК (с момента разрезания кинетохора каждую из них можно называть отдельной хромосомой) отделяются друг от друга и начинают расходиться к разным полюсам клетки. Это - момент начала анафазы (рис. 48, 4). Полуверетена в анафазе расходятся в разные стороны, причем каждое из них двигается как единое целое. Расхождение происходит за счет работы молекул белков-кинезинов. Каждая такая молекула, прикрепившись к микротрубочке одного полуверетена, тащит ее по микротрубочке второго полуверетена в направлении к "+"-концу (рис. 49).

В телофазе (рис. 48г)) происходит разборка микротрубочек веретена деления и образование двух ядер из мембранных пузырьков вокруг двух групп хромосом на полюсах клетки. Если стеклянной иглой отделить одну из хромосом от группы, то вокруг нее образуется отдельное маленькое ядро.

Последний этап митоза - деление цитоплазмы. У животных под мембраной клетки в районе ее экватора формируется кольцевой пучок актомиозина. Поочередно сокращаясь и перестраиваясь, он постепенно пережимает цитоплазму пополам, увлекая за собой мембрану.

! Механизм деления цитоплазмы в клетках растений

Рис. 50

У растений экваториальная плоскость заполняется мембранными пузырьками, затем они сливаются друг с другом, разделяя цитоплазму на две части (рис. 50).

? Какие выводы можно сделать из опытов, описанных в рассказе про деление клетки? Предложите гипотезы:

  1. о том, что мешает белкам, разрезающим кинетохоры хромосом, начать это делать до того, как все хромосомы окажутся в экваториальной плоскости клетки;
  2. о том, что заставляет мембранные пузырьки в телофазе митоза собираться вокруг хромосом.

Репликация ДНК осуществляется на основе:

    матричного синтеза,

    принципов: комплементарности и антипараллельности ,

    при участии ферментов: эндонуклеазы, ДНК – полимеразы , геликазы, ДНК - лигазы, топоизомеразы, РНК-проймазы .

В процессе репликации на каждой полинуклеотидной цепи материнской молекулы ДНК синтезируется комплиментарная ей цепь. В итоге из одной двойной спирали образуется две

идентичные двойные спирали, в которых одна полинуклеотидная цепь материнская, а вторая дочерняя, вновь синтезированная. Такой способ репликации называется полуконсервативным. Для осуществления репликации биспирали материнской ДНК, её цепи должны быть отделены друг от друга, чтобы стать матрицами. На которых будут синтезироваться комплиментарные и антипараллельные цепи дочерних полинуклеотидных цепей.

С помощью фермента г е л и к а з ы двойная спираль ДНК в отдельных зонах расплетается.. Образующиеся одноцепочные участки ДНК связываются специальными дестабилизирующими белками, растягивающими цепи и делая доступными азотистые основания для связывания с их с комплиментарными нуклеотидами.

Область расхождения полинуклеотидных цепей в зонах репликации называются

р е п л к а ц и о н н ы м и в и л к а м и. Образование репликационной вилки начинается с репликационного глаза, где две цепи материнской ДНК начинают отделяться друг от друга. Область репликационного глаза называют точкой начала репликации. Фрагмент ДНК от точки начала репликации до точки её окончания образует единицу репликации – репликон. Эукариотические хромосомы содержат большое число репликонов. В каждой такой области при участии фермента ДНК – п о л и м е р а з ы синтезируются новые дочерние цепи ДНК.

При расхождении 10 пар нуклеотидов, образующих один виток спирали, материнская ДНК должна совершить один полный оборот вокруг своей оси. Следовательно, для продвижения репликационной вилки вся молекула ДНК перед ней должна была бы быстро вращаться. В действительности этого не происходит благодаря ферментам т о п о и з о м е р а з а м. Топоизомераза разрывает фосфорнодиэфирную связь одной из цепей ДНК , что даёт ей возможность вращаться только вокруг второй цепи, что ослабляет накопившееся напряжение в двойной спирали ДНК.

ДНК – полимераза может присоединять очередной нуклеотид только!!! к ОН – группе дезоксирибозы в 3 / предшествующего нуклеотида, поэтому необходим 3 / - ОН – конец какой либо полинуклеотидной цепи, спаренной с матричной цепью ДНК, к которой ДНК – полимераза может лишь добавлять новые нуклеотиды. Такую полинуклеотидную цепь называют затравкой и ли праймером. Роль затравки для синтеза полинуклеотидных цепей ДНК в ходе репликации выполняют короткие последовательности РНК, образуемые при участии фермента РНК – праймазы. Такая особенность ДНК – полимеразы означает, что матрицей может служить лишь цепь ДНК, имеющая 3 \ ----5 \ конец. На ней происходит сборка новой дочерней цепи ДНК непрерывно от 5 / -----» 3 / концу.

Вторая дочерняя цепь ДНК также синтезируется с 3 / конца. Но вторая цепь материнской ДНК имеет 5 / ---» 3 / конец, поэтому синтез второй дочерней цепи ДНК осуществляется короткими фрагментами - фрагменты ОКАЗАКИ, также в направлении от 5 / -----» 3 / концу по типу шитья «назад иголкой», т.е. фермент ДНК – полимераза направлена противоположно относительно первой цепи, начинает работу с 3 / конца фрагмента Оказаки. У эукариот фрагменты Оказаки содержат от 100 до 200 нуклеотидов, а у прокариот значительно больше. Т.о. вилка репликации является асимметричной.

Из двух синтезируемых дочерних цепей та, что строится непрерывно, называется - лидирующей , синтез другой цепи идёт медленнее, т.к. она собирается фрагментами, её называют запаздывающей или отстающей.

Справа крупнейшая спираль ДНК человека, выстроенная из людей на пляже в Варне (Болгария), вошедшая в книгу рекордов Гиннесса 23 апреля 2016 года

Дезоксирибонуклеиновая кислота. Общие сведения

ДНК (дезоксирибонуклеиновая кислота) - своеобразный чертеж жизни, сложный код, в котором заключены данные о наследственной информации. Эта сложная макромолекула способна хранить и передавать наследственную генетическую информацию из поколения в поколение. ДНК определяет такие свойства любого живого организма как наследственность и изменчивость. Закодированная в ней информация задает всю программу развития любого живого организма. Генетически заложенные факторы предопределяют весь ход жизни как человека, так и любого др. организхма. Искусственное или естественное воздействие внешней среды способны лишь в незначительной степени повлиять на общую выраженность отдельных генетических признаков или сказаться на развитии запрограммированных процессов.

Дезоксирибонуклеи́новая кислота (ДНК) — макромолекула (одна из трёх основных, две другие — РНК и белки), обеспечивающая хранение, передачу из поколения в поколение и реализацию генетической программы развития и функционирования живых организмов. ДНК содержит информацию о структуре различных видов РНК и белков.

В клетках эукариот (животных, растений и грибов) ДНК находится в ядре клетки в составе хромосом, а также в некоторых клеточных органоидах (митохондриях и пластидах). В клетках прокариотических организмов (бактерий и архей) кольцевая или линейная молекула ДНК, так называемый нуклеоид, прикреплена изнутри к клеточной мембране. У них и у низших эукариот (например, дрожжей) встречаются также небольшие автономные, преимущественно кольцевые молекулы ДНК, называемые плазмидами.

С химической точки зрения ДНК — это длинная полимерная молекула, состоящая из повторяющихся блоков — нуклеотидов. Каждый нуклеотид состоит из азотистого основания, сахара (дезоксирибозы) и фосфатной группы. Связи между нуклеотидами в цепи образуются за счёт дезоксирибозы (С ) и фосфатной (Ф ) группы (фосфодиэфирные связи).


Рис. 2. Нуклертид состоит из азотистого основания, сахара (дезоксирибозы) и фосфатной группы

В подавляющем большинстве случаев (кроме некоторых вирусов, содержащих одноцепочечную ДНК) макромолекула ДНК состоит из двух цепей, ориентированных азотистыми основаниями друг к другу. Эта двухцепочечная молекула закручена по винтовой линии.

В ДНК встречается четыре вида азотистых оснований (аденин, гуанин, тимин и цитозин). Азотистые основания одной из цепей соединены с азотистыми основаниями другой цепи водородными связями согласно принципу комплементарности: аденин соединяется только с тимином (А-Т ), гуанин — только с цитозином (Г-Ц ). Именно эти пары и составляют «перекладины» винтовой "лестницы" ДНК (см.: рис. 2, 3 и 4).


Рис. 2. Азотистые основания

Последовательность нуклеотидов позволяет «кодировать» информацию о различных типах РНК, наиболее важными из которых являются информационные, или матричные (мРНК), рибосомальные (рРНК) и транспортные (тРНК). Все эти типы РНК синтезируются на матрице ДНК за счёт копирования последовательности ДНК в последовательность РНК, синтезируемой в процессе транскрипции, и принимают участие в биосинтезе белков (процессе трансляции). Помимо кодирующих последовательностей, ДНК клеток содержит последовательности, выполняющие регуляторные и структурные функции.


Рис. 3. Репликация ДНК

Расположение базовых комбинаций химических соединений ДНК и количественные соотношения между этими комбинациями обеспечивают кодирование наследственной информации.

Образование новой ДНК (репликация)

  1. Процесс репликации: раскручивание двойной спирали ДНК — синтез комплементарных цепей ДНК-полимеразой — образование двух молекул ДНК из одной.
  2. Двойная спираль «расстегивается» на две ветви, когда ферменты разрушают связь между базовыми парами химических соединений.
  3. Каждая ветвь является элементом новой ДНК. Новые базовые пары соединяются в той же последовательности, что и в родительской ветви.

По завершении дупликации образуются две самостоятельные спирали, созданные из химических соединений родительской ДНК и имеющие с ней одинаковый генетический код. Таким путем ДНК способна перерывать информацию от клетки к клетке.

Более подробная информация:

СТРОЕНИЕ НУКЛЕИНОВЫХ КИСЛОТ


Рис. 4 . Азотистые основания: аденин, гуанин, цитозин, тимин

Дезоксирибонуклеиновая кислота (ДНК) относится к нуклеиновым кислотам. Нуклеиновые кислоты - это класс нерегулярных биополимеров, мономерами которых являются нуклеотиды.

НУКЛЕОТИДЫ состоят из азотистого основания , соединенного с пятиуглеродным углеводом (пентозой) - дезоксирибозой (в случае ДНК) или рибозой (в случае РНК), который соединяется с остатком фосфорной кислоты (H 2 PO 3 -).

Азотистые основания бывают двух типов: пиримидиновые основания - урацил (только в РНК), цитозин и тимин, пуриновые основания - аденин и гуанин.


Рис. 5. Структура нуклеотидов (слева), расположение нуклеотида в ДНК (снизу) и типы азотистых оснований (справа): пиримидиновые и пуриновые


Атомы углерода в молекуле пентозы нумеруются числами от 1 до 5. Фосфат соединяется с третьим и пятым атомами углерода. Так нуклеинотиды соединяются в цепь нуклеиновой кислоты. Таким образом, мы можем выделить 3’ и 5’-концы цепи ДНК:


Рис. 6. Выделение 3’ и 5’-концов цепи ДНК

Две цепи ДНК образуют двойную спираль . Эти цепи в спирали сориентированы в противоположных направлениях. В разных цепях ДНК азотистые основания соединены между собой с помощью водородных связей . Аденин всегда соединяется с тимином, а цитозин - с гуанином. Это называется правилом комплементарности .

Правило комплементарности:

Например, если нам дана цепь ДНК, имеющая последовательность

3’- ATGTCCTAGCTGCTCG - 5’,

то вторая ей цепь будет комплементарна и направлена в противоположном направлении - от 5’-конца к 3’-концу:

5’- TACAGGATCGACGAGC- 3’.


Рис. 7. Направленность цепей молекулы ДНК и соединение азотистых оснований с помощью водородных связей

РЕПЛИКАЦИЯ ДНК

Репликация ДНК - это процесс удвоения молекулы ДНК путем матричного синтеза. В большинстве случаев естественной репликации ДНК праймером для синтеза ДНК является короткий фрагмент (создаваемый заново). Такой рибонуклеотидный праймер создается ферментом праймазой (ДНК-праймаза у прокариот, ДНК-полимераза у эукариот), и впоследствии заменяется дезоксирибонуклеотидами полимеразой, выполняющей в норме функции репарации (исправления химических повреждений и разрывов в молекле ДНК).

Репликация происходит по полуконсервативному механизму. Это значит, что двойная спираль ДНК расплетается и на каждой из ее цепей по принципу комплементарности достраивается новая цепь. Дочерняя молекула ДНК, таким образом, содержит в себе одну цепь от материнской молекулы и одну вновь синтезированную. Репликация происходит в направлении от 3’ к 5’ концу материнской цепи.

Рис. 8. Репликация (удвоение) молекулы ДНК

ДНК-синтез - это не такой сложный процесс, как может показаться на первый взгляд. Если подумать, то для начала нужно разобраться, что же такое синтез. Это процесс объединения чего-либо в одно целое. Образование новой молекулы ДНК проходит в несколько этапов:

1) ДНК-топоизомераза, располагаясь перед вилкой репликации, разрезает ДНК для того, чтобы облегчить ее расплетание и раскручивание.
2) ДНК-хеликаза вслед за топоизомеразой влияет на процесс «расплетения» спирали ДНК.
3) ДНК-связывающие белки осуществляют связывание нитей ДНК, а также проводят их стабилизацию, не допуская их прилипания друг к другу.
4) ДНК-полимераза δ (дельта), согласовано со скоростью движения репликативной вилки, осуществляет синтез ведущей цепи дочерней ДНК в направлении 5"→3" на матрице материнскойнити ДНК по направлению от ее 3"-конца к 5"-концу (скорость до 100 пар нуклеотидов в секунду). Этим события на данной материнской нити ДНК ограничиваются.



Рис. 9. Схематическое изображение процесса репликации ДНК: (1) Отстающая цепь (запаздывающая нить), (2) Ведущая цепь (лидирующая нить), (3) ДНК-полимераза α (Polα ), (4) ДНК-лигаза, (5) РНК-праймер, (6) Праймаза, (7) Фрагмент Оказаки, (8) ДНК-полимераза δ (Polδ ), (9) Хеликаза, (10) Однонитевые ДНК-связывающие белки, (11) Топоизомераза.

Далее описан синтез отстающей цепи дочерней ДНК (см. Схему репликативной вилки и функции ферментов репликации)

Нагляднее о репликации ДНК см.

5) Непосредственно сразу после расплетания и стабилизации другой нити материнской молекулы к ней присоединяется ДНК-полимераза α (альфа) и в направлении 5"→3" синтезирует праймер (РНК-затравку) - последовательность РНК на матрице ДНК длиной от 10 до 200 нуклеотидов. После этого фермент удаляется с нити ДНК.

Вместо ДНК-полимеразы α к 3"-концу праймера присоединяется ДНК-полимераза ε .

6) ДНК-полимераза ε (эпсилон) как бы продолжает удлинять праймер, но в качестве субстрата встраивает дезоксирибонуклеотиды (в количестве 150-200 нуклеотидов). В результате образуется цельная нить из двух частей - РНК (т.е. праймер) и ДНК . ДНК-полимераза ε работает до тех пор, пока не встретит праймер предыдущего фрагмента Оказаки (синтезированный чуть ранее). После этого данный фермент удаляется с цепи.

7) ДНК-полимераза β (бета) встает вместо ДНК-полимеразы ε , движется в том же направлении (5"→3") и удаляет рибонуклеотиды праймера, одновременно встраивая дезоксирибонуклеотиды на их место. Фермент работает до полного удаления праймера, т.е. пока на его пути не встанет дезоксирибонуклеотид (еще более ранее синтезированный ДНК-полимеразой ε ). Связать результат свой работы и впереди стоящую ДНК фермент не в состоянии, поэтому он сходит с цепи.

В результате на матрице материнской нити "лежит" фрагмент дочерней ДНК. Он называется фрагмент Оказаки .

8) ДНК-лигаза производит сшивку двух соседних фрагментов Оказаки , т.е. 5"-конца отрезка, синтезированного ДНК-полимеразой ε , и 3"-конца цепи, встроенного ДНК-полимеразой β .

СТРОЕНИЕ РНК

Рибонуклеиновая кислота (РНК) — одна из трёх основных макромолекул (две другие — ДНК и белки), которые содержатся в клетках всех живых организмов.

Так же, как ДНК, РНК состоит из длинной цепи, в которой каждое звено называется нуклеотидом . Каждый нуклеотид состоит из азотистого основания, сахара рибозы и фосфатной группы. Однако в отличие от ДНК, РНК обычно имеет не две цепи, а одну. Пентоза в РНК представлена рибозой, а не дезоксирибозой (у рибозы присутствует дополнительная гидроксильная группа на втором атоме углевода). Наконец, ДНК отличается от РНК по составу азотистых оснований: вместо тимина (Т ) в РНК представлен урацил (U ) , который также комплементарен аденину.

Последовательность нуклеотидов позволяет РНК кодировать генетическую информацию. Все клеточные организмы используют РНК (мРНК) для программирования синтеза белков.

Клеточные РНК образуются в ходе процесса, называемого транскрипцией , то есть синтеза РНК на матрице ДНК, осуществляемого специальными ферментами - РНК-полимеразами .

Затем матричные РНК (мРНК) принимают участие в процессе, называемом трансляцией, т.е. синтеза белка на матрице мРНК при участии рибосом. Другие РНК после транскрипции подвергаются химическим модификациям, и после образования вторичной и третичной структур выполняют функции, зависящие от типа РНК.

Рис. 10. Отличие ДНК от РНК по азотистому основанию: вместо тимина (Т) в РНК представлен урацил (U), который также комплементарен аденину.

ТРАНСКРИПЦИЯ

Это процесс синтеза РНК на матрице ДНК. ДНК раскручивается на одном из участков. На одной из цепей содержится информация, которую необходимо скопировать на молекулу РНК - эта цепь называется кодирующей. Вторая цепь ДНК, комплементарная кодирующей, называется матричной. В процессе транскрипции на матричной цепи в направлении 3’ - 5’ (по цепи ДНК) синтезируется комплементарная ей цепь РНК. Таким образом, создается РНК-копия кодирующей цепи.

Рис. 11. Схематическое изображение транскрипции

Например, если нам дана последовательность кодирующей цепи

3’- ATGTCCTAGCTGCTCG - 5’,

то, по правилу комплементарности, матричная цепь будет нести последовательность

5’- TACAGGATCGACGAGC- 3’,

а синтезируемая с нее РНК - последовательность

ТРАНСЛЯЦИЯ

Рассмотрим механизм синтеза белка на матрице РНК, а также генетический код и его свойства. Также для наглядности по ниже приведенной ссылке рекомендуем посмотреть небольшое видео о процессах транскрипции и трансляции, происходящих в живой клетке:

Рис. 12. Процесс синтеза белка: ДНК кодирует РНК, РНК кодирует белок

ГЕНЕТИЧЕСКИЙ КОД

Генетический код - способ кодирования аминокислотной последовательности белков с помощью последовательности нуклеотидов. Каждая аминокислота кодируется последовательностью из трех нуклеотидов - кодоном или триплетом.

Генетический код, общий для большинства про- и эукариот. В таблице приведены все 64 кодона и указаны соответствующие аминокислоты. Порядок оснований — от 5" к 3" концу мРНК.

Таблица 1. Стандартный генетический код

1-е
основа

ние

2-е основание

3-е
основа

ние

U

C

A

G

U

U U U

(Phe/F)

U C U

(Ser/S)

U A U

(Tyr/Y)

U G U

(Cys/C)

U

U U C

U C C

U A C

U G C

C

U U A

(Leu/L)

U C A

U A A

Стоп-кодон**

U G A

Стоп-кодон**

A

U U G

U C G

U A G

Стоп-кодон**

U G G

(Trp/W)

G

C

C U U

C C U

(Pro/P)

C A U

(His/H)

C G U

(Arg/R)

U

C U C

C C C

C A C

C G C

C

C U A

C C A

C A A

(Gln/Q)

C GA

A

C U G

C C G

C A G

C G G

G

A

A U U

(Ile/I)

A C U

(Thr/T)

A A U

(Asn/N)

A G U

(Ser/S)

U

A U C

A C C

A A C

A G C

C

A U A

A C A

A A A

(Lys/K)

A G A

A

A U G

(Met/M)

A C G

A A G

A G G

G

G

G U U

(Val/V)

G C U

(Ala/A)

G A U

(Asp/D)

G G U

(Gly/G)

U

G U C

G C C

G A C

G G C

C

G U A

G C A

G A A

(Glu/E)

G G A

A

G U G

G C G

G A G

G G G

G

Среди триплетов есть 4 специальных последовательности, выполняющих функции «знаков препинания»:

  • *Триплет AUG , также кодирующий метионин, называется старт-кодоном . С этого кодона начинается синтез молекулы белка. Таким образом, во время синтеза белка, первой аминокислотой в последовательности всегда будет метионин.
  • **Триплеты UAA , UAG и UGA называются стоп-кодонами и не кодируют ни одной аминокислоты. На этих последовательностях синтез белка прекращается.

Свойства генетического кода

1. Триплетность . Каждая аминокислота кодируется последовательностью из трех нуклеотидов - триплетом или кодоном.

2. Непрерывность . Между триплетами нет никаких дополнительных нуклеотидов, информация считывается непрерывно.

3. Неперекрываемость . Один нуклеотид не может входить одновременно в два триплета.

4. Однозначность . Один кодон может кодировать только одну аминокислоту.

5. Вырожденность . Одна аминокислота может кодироваться несколькими разными кодонами.

6. Универсальность . Генетический код одинаков для всех живых организмов.

Пример. Нам дана последовательность кодирующей цепи:

3’- CCGATTGCACGTCGATCGTATA - 5’.

Матричная цепь будет иметь последовательность:

5’- GGCTAACGTGCAGCTAGCATAT - 3’.

Теперь «синтезируем» с этой цепи информационную РНК:

3’- CCGAUUGCACGUCGAUCGUAUA - 5’.

Синтез белка идет в направлении 5’ → 3’, следовательно, нам нужно перевернуть последовательность, чтобы «прочитать» генетический код:

5’- AUAUGCUAGCUGCACGUUAGCC - 3’.

Теперь найдем старт-кодон AUG:

5’- AUAUG CUAGCUGCACGUUAGCC - 3’.

Разделим последовательность на триплеты:

звучит следующим образом: информация с ДНК передается на РНК (транскрипция), с РНК - на белок (трансляция). ДНК также может удваиваться путем репликации, и также возможен процесс обратной транскрипции, когда по матрице РНК синтезируется ДНК, но такой процесс в основном характерен для вирусов.


Рис. 13. Центральная догма молекулярной биологии

ГЕНОМ: ГЕНЫ и ХРОМОСОМЫ

(общие понятия)

Геном - совокупность всех генов организма; его полный хромосомный набор.

Термин "геном" был предложен Г. Винклером в 1920 г. для описания совокупности генов, заключенных в гаплоидном наборе хромосом организмов одного биологического вида. Первоначальный смысл этого термина указывал на то, что понятие генома в отличие от генотипа является генетической характеристикой вида в целом, а не отдельной особи. С развитием молекулярной генетики значение данного термина изменилось. Известно, что ДНК, которая является носителем генетической информации у большинства организмов и, следовательно, составляет основу генома, включает в себя не только гены в современном смысле этого слова. Большая часть ДНК эукариотических клеток представлена некодирующими ("избыточными") последовательностями нуклеотидов, которые не заключают в себе информации о белках и нуклеиновых кислотах. Таким образом, основную часть генома любого организма составляет вся ДНК его гаплоидного набора хромосом.

Гены — это участки молекул ДНК, кодирующие полипептиды и молекулы РНК

За последнее столетие наше представление о генах существенно изменилось. Ранее геном называли участок хромосомы, кодирующий или определяющий один признак или фенотипическое (видимое) свойство, например цвет глаз.

В 1940 г. Джордж Бидл и Эдвард Тейтем предложили молекулярное определение гена. Ученые обрабатывали споры гриба Neurospora crassa рентгеновским излучением и другими агентами, вызывающими изменения в последовательности ДНК (мутации ), и обнаружили мутантные штаммы гриба, утратившие некоторые специфические ферменты, что в некоторых случаях приводило к нарушению целого метаболического пути. Бидл и Тейтем пришли к выводу, что ген — это участок генетического материала, который определяет или кодирует один фермент. Так появилась гипотеза «один ген — один фермент» . Позднее эта концепция была расширена до определения «один ген — один полипептид» , поскольку многие гены кодируют белки, не являющиеся ферментами, а полипептид может оказаться субъединицей сложного белкового комплекса.

На рис. 14 показана схема того, как триплеты нуклеотидов в ДНК определяют полипептид - аминокислотную последовательность белка при посредничестве мРНК. Одна из цепей ДНК играет роль матрицы для синтеза мРНК, нуклеотидные триплеты (кодоны) которой комплементарны триплетам ДНК. У некоторых бактерий и многих эукариот кодирующие последовательности прерываются некодирующими участками(так называемыми интронами ).

Современное биохимическое определение гена еще более конкретно. Генами называются все участки ДНК, кодирующие первичную последовательность конечных продуктов, к которым относятся полипептиды или РНК, обладающие структурной или каталитической функцией.

Наряду с генами ДНК содержит и другие последовательности, выполняющие исключительно регуляторную функцию. Регуляторные последовательности могут обозначать начало или конец генов, влиять на транскрипцию или указывать место инициации репликации или рекомбинации. Некоторые гены могут экспрессироваться разными путями, при этом один и тот же участок ДНК служит матрицей для образования разных продуктов.

Мы можем приблизительно рассчитать минимальный размер гена , кодирующего средний белок. Каждая аминокислота в полипептидной цепи кодируется последовательностью из трех нуклеотидов; последовательности этих триплетов (кодонов) соответствуют цепочке аминокислот в полипептиде, который кодируется данным геном. Полипептидная цепь из 350 аминокислотных остатков (цепь средней длины) соответствует последовательности из 1050 п.н. (пар нуклеотидов ). Однако многие гены эукариот и некоторые гены прокариот прерываются сегментами ДНК, не несущими информации о белке, и поэтому оказываются значительно длиннее, чем показывает простой расчет.

Сколько генов в одной хромосоме?


Рис. 15. Вид хромосом в прокаритической (слева) и эукариотической клеках. Гистоны (Histones) — обширный класс ядерных белков, выполняющих две основные функции: они участвуют в упаковке нитей ДНК в ядре и в эпигенетической регуляции таких ядерных процессов, как транскрипция, репликация и репарация.

Как известно, бактериальные клетки имеют хромосому в виде нити ДНК, уложенной в компактную структуру - нуклеоид. Хромосома прокариота Escherichia coli , чей геном полностью расшифрован, представляет собой кольцевую молекулу ДНК (на самом деле, это не правильный круг, а скорее петля без начала и конца), состоящую из 4 639 675 п.н. В этой последовательности содержится примерно 4300 генов белков и еще 157 генов стабильных молекул РНК. В геноме человека примерно 3,1 млрд пар нуклеотидов, соответствующих почти 29 000 генам, расположенным на 24 разных хромосомах.

Прокариоты (Бактерии).

Бактерия E. coli имеет одну двухцепочечную кольцевую молекулу ДНК. Она состоит из 4 639 675 п.н. и достигает в длину примерно 1,7 мм, что превышает длину самой клетки E. coli приблизительно в 850 раз. Помимо крупной кольцевой хромосомы в составе нуклеоида многие бактерии содержат одну или несколько маленьких кольцевых молекул ДНК, свободно располагающихся в цитозоле. Такие внехромосомные элементы называют плазмидами (рис. 16).

Большинство плазмид состоит всего из нескольких тысяч пар нуклеотидов, некоторые содержат более 10000 п. н. Они несут генетическую информацию и реплицируются с образованием дочерних плазмид, которые попадают в дочерние клетки в процессе деления родительской клетки. Плазмиды обнаружены не только в бактериях, но также в дрожжах и других грибах. Во многих случаях плазмиды не дают никаких преимуществ клеткам-хозяевам, и их единственная задача — независимое воспроизведение. Однако некоторые плазмиды несут полезные для хозяина гены. Например, содержащиеся в плазмидах гены могут придавать клеткам бактерий устойчивость к антибактериальным агентам. Плазмиды, несущие ген β-лактамазы, обеспечивают устойчивость к β-лактамным антибиотикам, таким как пенициллин и амоксициллин. Плазмиды могут переходить от клеток, устойчивых к антибиотикам, к другим клеткам того же или другого вида бактерий, в результате чего эти клетки также становятся резистентными. Интенсивное применение антибиотиков является мощным селективным фактором, способствующим распространению плазмид, кодирующих устойчивость к антибиотикам (а также транспозонов, которые кодируют аналогичные гены) среди болезнетворных бактерий, и приводит к появлению бактериальных штаммов с устойчивостью к нескольким антибиотикам. Врачи начинают понимать опасность широкого использования антибиотиков и назначают их только в случае острой необходимости. По аналогичным причинам ограничивается широкое использование антибиотиков для лечения сельскохозяйственных животных.

См. также: Равин Н.В., Шестаков С.В. Геном прокариот // Вавиловский журнал генетики и селекции, 2013. Т. 17. № 4/2. С. 972-984.

Эукариоты.

Таблица 2. ДНК, гены и хромосомы некоторых организмов

Общая ДНК,

п.н.

Число хромосом*

Примерное число генов

Escherichia coli (бактерия)

4 639 675

4 435

Saccharomyces cerevisiae (дрожжи)

12 080 000

16**

5 860

Caenorhabditis elegans (нематода)

90 269 800

12***

23 000

Arabidopsis thaliana (растение)

119 186 200

33 000

Drosophila melanogaster (плодовая мушка)

120 367 260

20 000

Oryza sativa (рис)

480 000 000

57 000

Mus musculus (мышь)

2 634 266 500

27 000

Homo sapiens (человек)

3 070 128 600

29 000

Примечание. Информация постоянно обновляется; для получения более свежей информации обратитесь к сайтам, посвященным отдельным геномным проектам

* Для всех эукариот, кроме дрожжей, приводится диплоидный набор хромосом. Диплоидный набор хромосом (от греч. diploos- двойной и eidos- вид) - двойной набор хромосом (2n), каждая из которых имеет себе гомологичную.
**Гаплоидный набор. Дикие штаммы дрожжей обычно имеют восемь (октаплоидный) или больше наборов таких хромосом.
***Для самок с двумя Х хромосомами. У самцов есть Х хромосома, но нет Y, т. е. всего 11 хромосом.

В клетке дрожжей, одних из самых маленьких эукариот, в 2,6 раза больше ДНК, чем в клетке E. coli (табл. 2). Клетки плодовой мушки Drosophila , классического объекта генетических исследований, содержат в 35 раз больше ДНК, а клетки человека — примерно в 700 раз больше ДНК, чем клетки E. coli. Многие растения и амфибии содержат еще больше ДНК. Генетический материал клеток эукариот организован в виде хромосом. Диплоидный набор хромосом (2n ) зависит от вида организма (табл. 2).

Например, в соматической клетке человека 46 хромосом (рис. 17 ). Каждая хромосома эукариотической клетки, как показано на рис. 17, а , содержит одну очень крупную двухспиральную молекулу ДНК. Двадцать четыре хромосомы человека (22 парные хромосомы и две половые хромосомы X и Y) различаются по длине более чем в 25 раз. Каждая хромосома эукариот содержит определенный набор генов.


Рис. 17. Хромосомы эукариот. а — пара связанных и конденсированных сестринских хроматид из хромосомы человека. В такой форме эукариотические хромосомы пребывают после репликации и в метафазе в процессе митоза. б — полный набор хромосом из лейкоцита одного из авторов книги. В каждой нормальной соматической клетке человека содержится 46 хромосом.

Если соединить между собой молекулы ДНК человеческого генома (22 хромосомы и хромосомы X и Y или Х и Х), получится последовательность длиной около одного метра. Прим.: У всех млекопитающих и других организмов с гетерогаметным мужским полом, у самок две X-хромосомы (XX), а у самцов — одна X-хромосома и одна Y-хромосома (XY).

Большинство клеток человека , поэтому общая длина ДНК таких клеток около 2м. У взрослого человека примерно 10 14 клеток, таким образом, общая длина всех молекул ДНК составляет 2・10 11 км. Для сравнения, окружность Земли — 4・10 4 км, а расстояние от Земли до Солнца — 1,5・10 8 км. Вот как удивительно компактно упакована ДНК в наших клетках!

В клетках эукариот есть и другие органеллы, содержащие ДНК, — это митохондрии и хлоропласты. Выдвигалось множество гипотез относительно происхождения ДНК митохондрий и хлоропластов. Общепризнанная сегодня точка зрения заключается в том, что они представляют собой рудименты хромосом древних бактерий, которые проникли в цитоплазму хозяйских клеток и стали предшественниками этих органелл. Митохондриальная ДНК кодирует митохондриальные тРНК и рРНК, а также несколько митохондриальных белков. Более 95% митохондриальных белков кодируется ядерной ДНК.

СТРОЕНИЕ ГЕНОВ

Рассмотрим строение гена у прокариот и эукариот, их сходства и различия. Несмотря на то, что ген — это участок ДНК, кодирующий всего один белок или РНК, кроме непосредственно кодирующей части, он также включает в себя регуляторные и иные структурные элементы, имеющие разное строение у прокариот и эукариот.

Кодирующая последовательность - основная структурно-функциональная единица гена, именно в ней находятся триплеты нуклеотидов, кодирующие аминокислотную последовательность. Она начинается со старт-кодона и заканчивается стоп-кодоном.

До и после кодирующей последовательности находятся нетранслируемые 5’- и 3’-последовательности . Они выполняют регуляторные и вспомогательные функции, например, обеспечивают посадку рибосомы на и-РНК.

Нетранслируемые и кодирующая последовательности составлют единицу транскрипции - транскрибируемый участок ДНК, то есть участок ДНК, с которого происходит синтез и-РНК.

Терминатор - нетранскрибируемый участок ДНК в конце гена, на котором останавливается синтез РНК.

В начале гена находится регуляторная область , включающая в себя промотор и оператор .

Промотор - последовательность, с которой связывается полимераза в процессе инициации транскрипции. Оператор - это область, с которой могут связываться специальные белки - репрессоры , которые могут уменьшать активность синтеза РНК с этого гена - иначе говоря, уменьшать его экспрессию .

Строение генов у прокариот

Общий план строения генов у прокариот и эукариот не отличается - и те, и другие содержат регуляторную область с промотором и оператором, единицу транскрипции с кодирующей и нетранслируемыми последовательностями и терминатор. Однако организация генов у прокариот и эукариот отличается.

Рис. 18. Схема строения гена у прокариот (бактерий) - изображение увеличивается

В начале и в конце оперона есть единые регуляторные области для нескольких структурных генов. С транскрибируемого участка оперона считывается одна молекула и-РНК, которая содержит несколько кодирующих последовательностей, в каждой из которых есть свой старт- и стоп-кодон. С каждого из таких участков с интезируется один белок. Таким образом, с одной молекулы и-РНК синтезируется несколько молекул белка.

Для прокариот характерно объединение нескольких генов в единую функциональную единицу - оперон . Работу оперона могут регулировать другие гены, которые могут быть заметно удалены от самого оперона - регуляторы . Белок, транслируемый с этого гена называется репрессор . Он связывается с оператором оперона, регулируя экспрессию сразу всех генов, в нем содержащихся.

Для прокариот также характерно явление сопряжения транскрипции и трансляции .


Рис. 19 Явление сопряжения транскрипции и трансляции у прокариот - изображение увеличивается

Такое сопряжение не встречается у эукариот из-за наличия у них ядерной оболочки, отделяющей цитоплазму, где происходит трансляция, от генетического материала, на котором происходит транскрипция. У прокариот во время синтеза РНК на матрице ДНК с синтезируемой молекулой РНК может сразу связываться рибосома. Таким образом, трансляция начинается еще до завершения транскрипции. Более того, с одной молекулой РНК может одновременно связываться несколько рибосом, синтезируя сразу несколько молекул одного белка.

Строение генов у эукариот

Гены и хромосомы эукариот очень сложно организованы

У бактерий многих видов всего одна хромосома, и почти во всех случаях в каждой хромосоме присутствует по одной копии каждого гена. Лишь немногие гены, например гены рРНК, содержатся в нескольких копиях. Гены и регуляторные последовательности составляют практически весь геном прокариот. Более того, почти каждый ген строго соответствует аминокислотной последовательности (или последовательности РНК), которую он кодирует (рис. 14).

Структурная и функциональная организация генов эукариот гораздо сложнее. Исследование хромосом эукариот, а позднее секвенирование полных последовательностей геномов эукариот принесло много сюрпризов. Многие, если не большинство, генов эукариот обладают интересной особенностью: их нуклеотидные последовательности содержат один или несколько участков ДНК, в которых не кодируется аминокислотная последовательность полипептидного продукта. Такие нетранслируемые вставки нарушают прямое соответствие между нуклеотидной последовательностью гена и аминокислотной последовательностью кодируемого полипептида. Эти нетранслируемые сегменты в составе генов называют интронами , или встроенными последовательностями , а кодирующие сегменты — экзонами . У прокариот лишь немногие гены содержат интроны.

Итак, у эукариот практически не встречается объединение генов в опероны, и кодирующая последовательность гена эукариот чаще всего разделена на транслируемые участки - экзоны , и нетранслируемые участки - интроны.

В большинстве случаев функция интронов не установлена. В целом, лишь около 1,5% ДНК человека являются ≪кодирующими≫, т. е. несут информацию о белках или РНК. Однако с учетом крупных интронов получается, что ДНК человека на 30% состоит из генов. Поскольку гены составляют относительно небольшую долю в геноме человека, значительная часть ДНК остается неучтенной.

Рис. 16. Схема строение гена у эукариот - изображение увеличивается

С каждого гена сначала синтезируется незрелая, или пре-РНК, которая содержит в себе как интроны, так и экзоны.

После этого проходит процесс сплайсинга, в результате которого интронные участки вырезаются, и образуется зрелая иРНК, с которой может быть синтезирован белок.


Рис. 20. Процесс альтернативного сплайсинга - изображение увеличивается

Такая организация генов позволяет, например, осуществить , когда с одного гена могут быть синтезированы разные формы белка, за счет того, что в процессе сплайсинга экзоны могут сшиваться в разных последовательностях.

Рис. 21. Отличия в строении генов прокариот и эукариот - изображение увеличивается

МУТАЦИИ И МУТАГЕНЕЗ

Мутацией называется стойкое изменение генотипа, то есть изменение нуклеотидной последовательности.

Процесс, который приводит к возникновению мутаций называется мутагенезом , а организм, все клетки которого несут одну и ту же мутацию — мутантом .

Мутационная теория была впервые сформулирована Гуго де Фризом в 1903 году. Современный ее вариант включает в себя следующие положения:

1. Мутации возникают внезапно, скачкообразно.

2. Мутации передаются из поколения в поколение.

3. Мутации могут быть полезными, вредными или нейтральными, доминантными или рецессивными.

4. Вероятность обнаружения мутаций зависит от числа исследованных особей.

5. Сходные мутации могут возникать повторно.

6. Мутации не направленны.

Мутации могут возникать под действием различных факторов. Различают мутации, возникшие под действием мутагенных воздействий : физических (например, ультрафиолета или радиации), химических (например, колхицина или активных форм кислорода) и биологических (например, вирусов). Также мутации могут быть вызваны ошибками репликации .

В зависимости от условий появления мутации подразделяют на спонтанные — то есть мутации, возникшие в нормальных условиях, и индуцированые — то есть мутации, которые возникли при особых условиях.

Мутации могут возникать не только в ядерной ДНК, но и, например, в ДНК митохондрий или пластид. Соответственно, мы можем выделять ядерные и цитоплазматические мутации.

В результате возникновения мутаций часто могут появляться новые аллели. Если мутантный аллель подавляет действие нормального, мутация называется доминантной . Если нормальный аллель подавляет мутантный, такая мутация называется рецессивной . Большинство мутаций, приводящих к возникновению новых аллелей являются рецессивными.

По эффекту выделяют мутации адаптивные , приводящие к повышению приспособленности организма к среде, нейтральные , не влияющие на выживаемость, вредные , понижающие приспособленность организмов к условиям среды и летальные , приводящие к смерти организма на ранних стадиях развития.

По последствиям выделяются мутации, приводящие к потери функции белка , мутации, приводящие к возникновению у белка новой функции , а также мутации, которые изменяют дозу гена , и, соответственно, дозу белка синтезируемого с него.

Мутация может возникнуть к любой клетке организма. Если мутация возникает в половой клетке, она называется герминативной (герминальной, или генеративной). Такие мутации не проявляются у того организма, у которого они появились, но приводят к появлению мутантов в потомстве и передаются по наследству, поэтому они важны для генетики и эволюции. Если мутация возникает в любой другой клетке, она называется соматической . Такая мутация может в той или иной степени проявляться у того организма, у которого она возникла, например, приводить к образованию раковых опухолей. Однако такая мутация не передается по наследству и не влияет на потомков.

Мутации могут затрагивать разные по размеру участки генома. Выделяют генные , хромосомные и геномные мутации.

Генные мутации

Мутации, которые возникают в масштабе меньшем, чем один ген, называются генными , или точечными (точковыми) . Такие мутации приводят к изменению одного и нескольких нуклеотидов в последовательности. Среди генных мутаций выделяют замены , приводящие к замене одного нуклеотида на другой, делеции , приводящие к выпадению одного из нуклеотидов, инсерции , приводящие к добавлению лишнего нуклеотида в последовательность.


Рис. 23. Генные (точечные) мутации

По механизму воздействия на белок, генные мутации делят на: синонимичные , которые (в результате вырожденности генетического кода) не приводят к изменению аминокислотного состава белкового продукта, миссенс-мутации , которые приводят к замене одной аминокислоты на другую и могут влиять на структуру синтезируемого белка, хотя часто они оказываются незначительными, нонсенс-мутации , приводящие к замене кодирующего кодона на стоп-кодон, мутации, приводящие к нарушению сплайсинга:


Рис. 24. Схемы мутаций

Также по механизму воздействия на белок выделяют мутации, приводящие к сдвигу рамки считывания , например, инсерции и делеции. Такие мутации, как и нонсенс-мутации, хоть и возникают в одной точке гена, часто воздействуют на всю структуру белка, что может привести к полному изменению его структуры.

Рис. 29. Хромосома до и после дупликации

Геномные мутации

Наконец, геномные мутации затрагивают весь геном целиком, то есть меняется количество хромосом. Выделяют полиплоидии — увеличение плоидности клетки, и анеуплоидии, то есть изменение количества хромосом, например, трисомии (наличие у одной из хромосом дополнительного гомолога) и моносомии (отсутствие у хромосомы гомолога).

Видео по теме ДНК

РЕПЛИКАЦИЯ ДНК, КОДИРОВАНИЕ РНК, СИНТЕЗ БЕЛКА

Перед каждым клеточным делением при абсолютно точном соблюдении нуклеотидной последовательности происходит самоудвоение (редупликация) молекулы ДНК. Редупликация начинается с того, что двойная спираль ДНК временно раскручивается. Это происходит под действием фермента ДНК-полимеразы в среде, в которой содержатся свободные нуклеотиды. Каждая одинарная цепь по принципу химического сродства (А - Т, Г - Ц) притягивает к своим нуклеотидным остаткам и закрепляет водородными связями свободные нуклеотиды, находящиеся в клетке. Таким образом, каждая полинуклеотидная цепь выполняет роль матрицы для новой комплиментарной цепи. В результате получаются две молекулы ДНК, у каждой из них одна половина происходит от родительской молекулы, а другая является вновь синтезированной, т.е. две новые молекулы ДНК представляют собой точную копию исходной молекулы.

Белки

Белки - обязательная составная часть всех клеток. В жизни всех организмов белки имеют первостепенное значение. В состав белка входят углерод, водород, азот, некоторые белки содержат еще и серу. Роль мономеров в белках играют аминокислоты. У каждой аминокислоты имеется карбоксильная группа (-СООН) и аминогруппа (-NH 2). Наличие в одной молекуле кислотной и основной групп обусловливает их высокую реактивность. Между соединившимися аминокислотами возникает связь называемая пептидной , а образовавшееся соединение нескольких аминокислот называют пептидом . Соединение из большого числа аминокислот называют полипептидом .

В белках встречаются 20 аминокислот, отличающихся друг от друга своим строением. Разные белки образуются в результате соединения аминокислот в разной последовательности. Огромное разнообразие живых существ в значительной степени определяется различиями в составе имеющихся у них белков.

В строении молекул белков различают четыре уровня организации:

Первичная структура - полипептидная цепь из аминокислот, связанных в определенной последовательности ковалентными (прочными) пептидными связями.

Вторичная структура - полипептидная цепь, закрученная в виде спирали. В ней между соседними витками возникают мало прочные водородные связи. В комплексе они обеспечивают довольно прочную структуру.

Третичная структура представляет собой причудливую, но для каждого белка специфическую конфигурацию - глобулу. Она удерживается мало прочными гидрофобными связями или силами сцепления между неполярными радикалами, которые встречаются у многих аминокислот. Благодаря их многочисленности они обеспечивают достаточную устойчивость белковой макромолекулы и ее подвижность. Третичная структура белков поддерживается также ковалентными S-S-связями возникающими между удаленными друг от друга радикалами серосодержащей аминокислоты - цистеина.

Благодаря соединению нескольких молекул белков между собой образуется четвертичная структура. Если пептидные цепи уложены в виде клубка, то такие белки называются глобулярными . Если полипептидные цепи уложены в пучки нитей, они носят название фибриллярных белков .

Нарушение природной структуры белка называют денатурацией . Она может возникать под действием высокой температуры, химических веществ, радиации и т.д. Денатурация может быть обратимой (частичное нарушение четвертичной структуры) и необратимой (разрушение всех структур).

ФУНКЦИИ:

Биологические функции белков в клетке чрезвычайно многообразны. Они в значительной мере обусловлены сложностью и разнообразием форм и состава самих белков.

1 Строительная функция - построены органоиды.

2 Каталитическая - белки ферменты.(амилаза,превращает крахмал в глюкозу)

Учебник для 10-11 классов

Глава IV. Наследственная информация и реализация ее в клетке

Организмы обладают способностью передавать следующим поколениям свои признаки и особенности, т. е. воспроизводить себе подобных. Это явление наследования признаков основано на передаче из поколения в поколение наследственной информации. Материальным носителем этой информации являются молекулы ДНК.

Передача наследственной информации от одного поколения клеток к другому, от одного поколения организмов к последующему обеспечивается некоторыми фундаментальными свойствами ДНК. Она удваивается в каждом поколении клеток и может неопределенно долго воспроизводиться без каких-либо изменений. Относительно редкие изменения наследственной информации также могут воспроизводиться и передаваться от поколения к поколению.

Одна из самых замечательных особенностей жизни состоит в том, что все живые существа характеризуются общностью строения клеток и происходящих в них процессов (см. § 7). Однако они имеют и очень много различий. Даже особи одного вида различаются по многим свойствам и признакам: морфологическим, физиологическим, биохимическим.

Современная биология показала, что в своей основе сходство и различие организмов определяются в конечном счете набором белков. Чем ближе организмы друг к другу в систематическом положении, тем более сходны их белки.

Некоторые белки, выполняющие одинаковые функции, могут иметь сходное строение в клетках не только разных видов, но даже более далеких групп организмов. Например, инсулин (гормон поджелудочной железы), регулирующий уровень сахара в крови, близок по строению у собаки и человека. Однако большинство белков, выполняя одну и ту же функцию, несколько отличаются по строению у разных представителей одного и того же вида. Примером могут служить белки групп крови у человека. Такое разнообразие белков лежит в основе специфичности каждого организма.

Известно, что в эритроцитах (красных кровяных клетках дисковидной формы) содержится белок гемоглобин, который доставляет кислород ко всем клеткам тела. Это сложный белок. Каждая его молекула состоит из четырех полипептидных цепей. У людей, страдающих тяжелым наследственным заболеванием - серповидноклеточной анемией, эритроциты похожи не на диски, как обычно, а на серпы. Причина изменения формы клетки - в различии первичной структуры гемоглобина у больных и здоровых людей. В чем же это различие? В двух из четырех цепей нормального гемоглобина на шестом месте стоит глутаминовая кислота. При серповидноклеточной анемии она заменена на аминокислоту валин. Из 574 аминокислот, входящих в состав гемоглобина, заменены только две (по одной в двух цепях). Но это приводит к существенному изменению третичной и четвертичной структуры белка и, как следствие, к изменению формы и нарушению функции эритроцита. Серповидные эритроциты плохо справляются со своей задачей - переносом кислорода.

ДНК - матрица для синтеза белков. Каким же образом в эритроцитах здорового человека образуются миллионы идентичных молекул гемоглобина, как правило, без единой ошибки в расположении аминокислот? Почему в эритроцитах больных серповидноклеточной анемией все молекулы гемоглобина имеют одну и ту же ошибку в одном и том же месте?

Для ответа на эти вопросы обратимся к примеру с книгопечатанием. Учебник, который вы держите в руках, издан тиражом n экземпляров. Все n книг отпечатаны с одного шаблона - типографской матрицы, поэтому они совершенно одинаковы. Если бы в матрицу вкралась ошибка, то она была бы воспроизведена во всех экземплярах. Роль матрицы в клетках живых организмов выполняют молекулы ДНК. ДНК каждой клетки несет информацию не только о структурных белках, определяющих форму клетки (вспомните эритроцит), но и о всех белках-ферментах, белках-гормонах и других белках.

Углеводы и липиды образуются в клетке в результате сложных химических реакций, каждая из которых катализируется своим белком-ферментом. Владея информацией о ферментах, ДНК программирует структуру и других органических соединений, а также управляет процессами их синтеза и расщепления.

Поскольку молекулы ДНК являются матрицами для синтеза всех белков, в ДНК заключена информация о структуре и деятельности клеток, о всех признаках каждой клетки и организма в целом.

Каждый белок представлен одной или несколькими полипептидными цепями. Участок молекулы ДНК, служащий матрицей для синтеза одной полипептидной цепи, т. е. в большинстве случаев одного белка, называют геном. Каждая молекула ДНК содержит множество разных генов. Всю информацию, заключенную в молекулах ДНК, называют генетической, а всю совокупность ДНК клетки называют геномом. Идея о матричном принципе синтеза белков впервые была сформулирована еще в 20-х гг. XX в. выдающимся отечественным биологом Николаем Константиновичем Кольцовым.

НИКОЛАЙ КОНСТАНТИНОВИЧ КОЛЬЦОВ (1872- 1940) - отечественный зоолог, цитолог, генетик. Основоположник экспериментального метода исследований в биологии в нашей стране. Впервые выступил с теорией матричной репродукции хромосом. Основатель Института экспериментальной биологии. Был инициатором создания Всесоюзного института экспериментальной медицины, на основе которого впоследствии была создана Академия медицинских наук.

Удвоение ДНК. Молекулы ДНК обладают поразительным свойством, не присущим ни одной другой из известных молекул, - способностью к удвоению. Что представляет собой процесс удвоения? Вы помните, что двойная спираль ДНК построена по принципу комплементарности (см. рис. 7). Этот же принцип лежит в основе удвоения молекул ДНК. С помощью специальных ферментов водородные связи, скрепляющие нити ДНК, разрываются, нити расходятся, и к каждому нуклеотиду каждой из этих нитей последовательно пристраиваются комплементарные нуклеотиды. Разошедшиеся нити исходной (материнской) молекулы ДНК являются матричными - они задают порядок расположения нуклеотидов во вновь синтезируемой цепи. В результате действия сложного набора ферментов происходит соединение нуклеотидов друг с другом. При этом образуются новые нити ДНК, комплементарные каждой из разошедшихся цепей (рис. 21). Таким образом, в результате удвоения создаются две двойные спирали ДНК (дочерние молекулы), каждая из них имеет одну нить, полученную от материнской молекулы, и одну нить, синтезированную вновь.

Рис. 21. Схема удвоения ДНК

Процесс матричного синтеза ДНК, осуществляемый ферментами ДНК-полимеразами, называют репликацией.

Дочерние молекулы ДНК ничем не отличаются друг от друга и от материнской молекулы. При делении клетки дочерние молекулы ДНК расходятся по двум образующимся клеткам, каждая из которых вследствие этого будет иметь ту же информацию, которая содержалась в материнской клетке. Так как гены - это участки молекул ДНК, то две дочерние клетки, образующиеся при делении, имеют одинаковые гены.

Каждая клетка многоклеточного организма возникает из одной зародышевой клетки в результате многократных делений, поэтому все клетки организма имеют одинаковый набор генов. Случайно возникшая ошибка в гене зародышевой клетки будет воспроизведена в генах миллионов ее потомков. Вот почему все эритроциты больного серповидноклеточной анемией имеют одинаково «испорченный» гемоглобин. Дети, больные анемией, получают «испорченные» гены от родителей через их половые клетки. Информация, заключенная в ДНК клеток (генетическая информация), передается не только из клетки в клетку, но и от родителей к детям. (Подробно об этом будет рассказано в главе VII.) Ген является единицей генетической, или наследственной, информации.

Трудно, глядя на типографскую матрицу, судить о том, хорошая или плохая книга будет по ней напечатана. Невозможно судить и о качестве генетической информации по тому, «хороший» или «плохой» ген получили потомки по наследству, до тех пор, пока на основе этой информации не будут построены белки и не разовьется целый организм.

  1. Какие вещества обусловливают индивидуальные различия организмов?
  2. Может ли замена одной аминокислоты в полипептидной цепи сказаться на функции белка?
  3. Как вы понимаете фразу: «Молекулы ДНК - матрицы для синтеза белков»?
  4. Какой принцип лежит в основе удвоения молекул ДНК?
  5. Одинакова ли генетическая информация в клетке печени и в нервной клетке одного и того же организма?

28 февраля 2003 года исполнилось 50 лет со дня открытия структуры ДНК Френсисом Криком и Джеймсом Уотсоном, которое совершило революцию в биологии и медицине.: Lenta.ru

Начало этой истории можно принять за шутку. "А мы только что открыли секрет жизни!" – сказал один из двоих мужчин, вошедших в кембриджский Игл паб (Eagle pub) ровно 50 лет назад – 28 февраля 1953 года. И эти люди, работавшие в лаборатории неподалеку, нисколько не преувеличивали. Одного из них звали Френсис Крик (Francis Crick), а другого – Джеймс Уотсон (James Watson).

Уотсон и Крик открыли структуру дезоксирибонуклеиновой кислоты (ДНК) – вещества, которое содержит всю наследственную информацию. Через несколько месяцев после исторического заявления в пабе вышла осторожная публикация работы двух исследователей в журнале Nature (Watson J.D., Crick F.H.C. Molecular structure of nucleic acids // Nature. 1953. V. 171. P. 738-740). Статья заканчивалась предположением о том, что открытие структуры ДНК может объяснить механизмы копирования генетического материала.

К пятидесятым годам было известно, что ДНК – большая молекула, которая состоит из тысяч соединенных между собой в линию маленьких молекул четырех разных видов – нуклеотидов. Также ученые знали, что именно ДНК отвечает за хранение и передачу по наследству генетической информации, похожей на текст, написанный алфавитом из четырех букв. Неизвестными оставались пространственная структура этой молекулы и механизмы, по которым ДНК передается по наследству от клетки к клетке и от организма к организму.

В 1948 году Лайнус Полинг (Linus Pauling) открыл пространственную структуру других макромолекул – белков. Прикованный нефритом к постели Полинг несколько часов складывал бумагу, которой он пытался смоделировать конфигурацию белковой молекулы, и создал модель структуры, названной "альфа-спиралью".

По словам Уотсона, после этого открытия в их лаборатории была популярна гипотеза о спиральном строении ДНК. Уотсон и Крик сотрудничали с ведущими специалистами по рентгеноструктурному анализу, а Крик умел практически безошибочно обнаруживать признаки спирали на снимках, полученных таким способом.

Полинг тоже считал, что ДНК – спираль, причем, состоящая из трех нитей. Однако, он не мог объяснить ни природы такой структуры, ни механизмы самоудвоения ДНК для передачи дочерним клеткам.

Открытие двуспиральной структуры произошло после того, как Морис Уилкинс (Maurice Wilkins) тайно показал Уотсону и Крику рентгеновский снимок молекулы ДНК, сделанный его сотрудницей Розалинд Франклин (Rosalind Franklin). На этом снимке они четко узнали признаки спирали и направились в лабораторию, чтобы проверить все на объемной модели.

В лаборатории выяснилось, что мастерская не поставила необходимые для стереомодели металлические пластины, и Уотсон вырезал из картона четыре вида макетов нуклеотидов – гуанина (G), цитозина (C), тимина (T) и аденина (A) – и стал раскладывать их на столе. И тут он обнаружил, что аденин соединяется с тимином, а гуанин – с цитозином по принципу "ключ-замок". Именно таким образом соединяются между собой две нити спирали ДНК, то есть напротив тимина из одной нити всегда будет находиться аденин из другой, и ничто иное.

Такое расположение позволило объяснить механизмы копирования ДНК: две нити спирали расходятся, и к каждой из них достраивается из нуклеотидов точная копия ее бывшей "партнерши" по спирали. По такому же принципу, как с негатива в фотографии печатают позитив.

Очень печально сложилась судьба Розалинд Франклин. Уилкинс называл свою подчиненную исключительно "синим чулком" и находился с ней в постоянном конфликте. Хоть Франклин и не поддерживала гипотезу о спиральном строении ДНК, именно ее снимки сыграли решающую роль в открытии Уотсона и Крика. И, может, Полинг удостоился бы четвертой Нобелевской премии, если бы он смог увидеть эти снимки раньше, чем британские исследователи.

До премии, которую получили Уилкинс, Уотсон и Крик, Розалинд не дожила. Она скончалась от рака в 1958 году.

Очевидно, что открытие пространственной структуры ДНК совершило революцию в мире науки и повлекло за собой целый ряд новых открытий, без которых нельзя представить не только современную науку, но и современную жизнь в целом

В шестидесятых годах прошлого века предположение Уотсона и Крика о механизме репликации (удвоения) ДНК полностью подтвердилось. Кроме того, было показано, что в этом процессе принимает участие специальный белок – ДНК-полимераза.

Примерно в то же время было совершено другое важное открытие – генетический код. Как уже говорилось выше, ДНК содержит в себе информацию обо всем, что передается по наследству, в том числе о линейной структуре каждого белка в организме. Белки, как и ДНК, представляют длинные молекулярные цепочки из аминокислот. Этих аминокислот 20. Соответственно, было неясно каким образом "язык" ДНК, состоящий из четырехбуквенного алфавита переводятся на "язык" белков, где используется 20 "букв".

Оказалось, что сочетание из трех нуклеотидов ДНК четко соответствует одной из 20 аминокислот. И, таким образом "написанное" на ДНК однозначно переводится в белок.

В семидесятых годах появились еще два важнейших метода, основанные на открытии Уотсона и Крика. Это секвенирование и получение рекомбинатной ДНК. Секвенирование позволяет "прочитать" последовательность нуклеотидов в ДНК. Именно на этом методе основана вся программа "Геном человека".

Получение рекомбинантной ДНК по другому называют молекулярным клонированием. Суть этого метода заключается в том, что в молекулу ДНК встраивают фрагмент, содержащий определенный ген. Таким образом, например получают бактерии, которые содержат ген человеческого инсулина. Инсулин, полученный таким способом, называется рекомбинатным. Этим же методом созданы все "генетически модифицированные продукты".

Как ни парадоксально, репродуктивное клонирование, о котором сейчас все говорят, появилось раньше, чем была открыта структура ДНК. Понятно, что сейчас учеными, проводящие такие эксперименты, активно используются результаты открытия Уотсона и Крика. Но, изначально, метод не базировался на нем.

Следующим важным шагом науки стала разработка в восьмидесятых годах полимеразно-цепной реакции. Эта технология используется для быстрого "размножения" нужного фрагмента ДНК и уже нашла множество применений как в науке, так в медицине и технологии. В медицине с помощью ПЦР проводят быструю и точную диагностику вирусных заболеваний. Если в массе ДНК, полученной из анализа пациента, даже в минимальном количестве есть гены, принесенные вирусом, то с помощью ПЦР можно добиться их "размножения" и после этого легко идентифицировать.

Кроме того, что открытие Уотсона и Крика стало основой множества научных исследований, включая знаменитый проект "Геном человека", молекула ДНК оставила след в современной живописи, кинематографе, архитектуре.

Урок 7. генетическая информация её реализация в клетке. ген. геном. реакции матричного синтеза - Биология - 10 класс

В живых системах встречаются химические реакции, неизвестные в неживой природе – реакции матричного синтеза.

Термином «матрица» в технике обозначают форму, употребляемую для отливки монет, медалей, типографского шрифта: затвердевший металл в точности воспроизводит все детали формы, служившей для отливки. Матричный синтез напоминает отливку на матрице: новые молекулы синтезируются в точном соответствии с планом, заложенным в структуре уже существующих молекул.

Матричный принцип лежит в основе важнейших синтетических реакций клетки, таких, как синтез нуклеиновых кислот и белков. В этих реакциях обеспечивается точная, строго специфичная последовательность мономерных звеньев в синтезируемых полимерах.

Роль матрицы в матричных реакциях играют макромолекулы нуклеиновых кислот ДНК или РНК.

Матричный тип реакций – специфическая особенность химизма живых систем. Они являются основой фундаментального свойства всего живого – его способности к воспроизведению себе подобного.

К реакциям матричного синтеза относятся:

1. репликация ДНК – процесс самоудвоения молекулы ДНК, осуществляемый под контролем ферментов. На каждой из цепей ДНК, образовавшихся после разрыва водородных связей, при участии фермента ДНК-полимеразы синтезируется дочерняя цепь ДНК. Материалом для синтеза служат свободные нуклеотиды, имеющиеся в цитоплазме клеток.

Биологический смысл репликации заключается в точной передаче наследственной информации от материнской молекулы к дочерним, что в норме и происходит при делении соматических клеток.

2. транскрипция – синтез иРНК на ДНК, процесс снятия информации с молекулы ДНК, синтезируемой на ней молекулой иРНК.

иРНК состоит из одной цепи и синтезируется на ДНК в соответствии с правилом комплементарности при участии фермента – РНК-полимеразы. Готовая молекула иРНК выходит в цитоплазму на рибосомы, где происходит синтез полипептидных цепей.

3. трансляция – синтез белка на иРНК; процесс перевода информации, содержащейся в последовательности нуклеотидов иРНК, в последовательность аминокислот в полипептиде.

Биосинтез белка – это один из видов пластического обмена, в ходе которого наследственная информация, закодированная в генах ДНК, реализуется в определённую последовательность аминокислот в белковых молекулах. Рибосома представляет собой как бы конвейер для сборки цепочки белка из поступающих в него различных аминокислот. Каждой аминокислоте соответствует строго специфическая тРНК, которая находит «свою» аминокислоту и переносит её в рибосому.

Одновременно с тРНК, на которой «сидит» своя аминокислота, в рибосому поступает «сигнал» от ДНК, содержащейся в ядре. В соответствии с этим сигналом в рибосоме синтезируется тот или иной белок.

Направляющее влияние ДНК на синтез белка осуществляется не непосредственно, а с помощью особого посредника – матричной или информационной РНК (мРНК или иРНК), которая синтезируется в ядре под влиянием ДНК, поэтому её состав отражает состав ДНК. Молекула РНК представляет собой как бы слепок с формы ДНК. Синтезированная иРНК поступает в рибосому и передаёт ей план – в каком порядке должны соединяться друг с другом поступившие в рибосому аминокислоты, чтобы синтезировался определённый белок. Иначе, генетическая информация, закодированная в ДНК, передаётся на иРНК и далее на белок.

Молекула иРНК поступает в рибосому и соединяется с ней. Тот её отрезок, который находится в данный момент в рибосоме, состоит из двух триплетов (кодонов) . Каждый триплет взаимодействует совершенно специфично с подходящим к нему по строению триплетом (антикодоном) в транспортной РНК, которая принесла в рибосому аминокислоту.

Транспортная РНК со своей аминокислотой подходит к определённому кодону иРНК и соединяется с ним; к следующему, соседнему участку иРНК присоединяется другая тРНК с другой аминокислотой. Между аминокислотами образуется пептидная связь. Затем рибосома перемещается на он триплет, первая тРНК освобождается от своей аминокислоты и выходит из рибосомы, а на освободившееся место приходит следующая тРНК. Процесс продолжается до тех пор, пока не будет считана вся цепочка и-РНК до стоп-кодона.

В процессе синтеза белка как правило одновременно участвуют несколько рибосом , образующих комплекс полирибосому.

Основные этапы передачи генетической информации:

синтез на ДНК как на матрице иРНК (транскрипция)

синтез в рибосомах полипептидной цепи по программе, содержащейся в иРНК (трансляция).

Этапы универсальны для всех живых существ, но временные и пространственные взаимоотношения этих процессов различаются у про- и эукариотов.

У эукариот транскрипция и трансляция строго разделены в пространстве и времени: синтез различных РНК происходит в ядре, после чего молекулы РНК должны покинуть пределы ядра, пройдя через ядерную мембрану. Затем в цитоплазме РНК транспортируются к месту синтеза белка – рибосомам. Лишь после этого наступает следующий этап – трансляция.

У прокариот транскрипция и трансляция идут одновременно.

Таким образом,

местом синтеза всех белков, в том числе ферментов в клетке являются рибосомы – это как бы «фабрики» белка, сборочный цех, куда поступают все материалы, необходимые для сборки полипептидной цепочки белка из аминокислот. Природа синтезируемого белка зависит от строения иРНК, от порядка расположения в ней нуклеоидов, а строение иРНК отражает строение ДНК, так что в конечном итоге специфическое строение белка, т. е. порядок расположения в нём различных аминокислот, зависит от порядка расположения нуклеотидов в ДНК, от строения ДНК.

Изложенная теория биосинтеза белка получила название матричной теории. Матричной эта теория называется потому, что нуклеиновые кислоты играют роль матриц, в которых записана вся информация относительно последовательности аминокислотных остатков в молекуле белка.

Создание матричной теории биосинтеза белка и расшифровка аминокислотного кода является крупнейшим научным достижением XX века, важнейшим шагом на пути к выяснению молекулярного механизма наследственности.

Что такое репликация ДНК? | Факты

Репликация ДНК - это процесс, с помощью которого ДНК копирует себя во время деления клетки.

  1. Первым шагом в репликации ДНК является «расстегивание» двойной спиральной структуры молекулы ДНК.
  2. Это осуществляется ферментом под названием геликаза, который разрывает водородные связи, удерживающие вместе комплементарные основания ДНК (A с T, C с G).
  3. Разделение двух одиночных цепей ДНК создает Y-образную форму, называемую репликационной «вилкой».Две разделенные нити будут действовать как шаблоны для создания новых цепей ДНК.
  4. Одна из нитей ориентирована в направлении от 3 ’к 5’ (к вилке репликации), это ведущая нить. Другая нить ориентирована в направлении от 5 ’к 3’ (от вилки репликации), это отстающая нить. В результате их разной ориентации две нити реплицируются по-разному:

Иллюстрация, показывающая репликацию ведущей и отстающей цепей ДНК.
Изображение предоставлено: Genome Research Limited

  1. Ведущая цепь:
  2. Короткий фрагмент РНК, называемый праймером (продуцируемый ферментом, называемым праймазой), проходит и связывается с концом ведущей цепи. Праймер действует как отправная точка для синтеза ДНК.
  3. ДНК-полимераза связывается с ведущей цепью, а затем «идет» по ней, добавляя новые комплементарные нуклеотидные основания (A, C, G и T) к цепи ДНК в направлении от 5 ’к 3’.
  4. Такой вид репликации называется непрерывным.
  1. Отстающая цепь:
  2. Многочисленные праймеры РНК создаются ферментом примазой и связываются в различных точках вдоль отстающей цепи.
  3. Куски ДНК, называемые фрагментами Окадзаки, затем добавляются к отстающей цепи также в направлении от 5 ’к 3’.
  4. Этот тип репликации называется прерывистой, так как фрагменты Окадзаки нужно будет соединить позже.

  1. После того, как все основания совпадают (A с T, C с G), фермент, называемый экзонуклеазой, удаляет праймер (ы).Затем пустоты, на которых находился праймер (ы), заполняются еще более комплементарными нуклеотидами.
  2. Новая цепь проверяется, чтобы убедиться в отсутствии ошибок в новой последовательности ДНК.
  3. Наконец, фермент под названием ДНК-лигаза запечатывает последовательность ДНК в две непрерывные двойные цепи.
  4. Результатом репликации ДНК являются две молекулы ДНК, состоящие из одной новой и одной старой цепочки нуклеотидов. Вот почему репликация ДНК описывается как полуконсервативная, половина цепи является частью исходной молекулы ДНК, половина - совершенно новой.
  5. После репликации новая ДНК автоматически сворачивается в двойную спираль.

Эта страница последний раз обновлялась 25.01.2016

Этапы и процесс репликации ДНК

Зачем реплицировать ДНК?

ДНК - это генетический материал, который определяет каждую клетку. Прежде чем клетка дублируется и делится на новые дочерние клетки посредством митоза или мейоза, биомолекулы и органеллы должны быть скопированы для распределения между клетками.ДНК, обнаруженная в ядре, должна реплицироваться, чтобы гарантировать, что каждая новая клетка получит правильное количество хромосом. Процесс дублирования ДНК называется Репликация ДНК . Репликация состоит из нескольких этапов, в которых задействованы несколько белков, называемых ферментами репликации и РНК. В эукариотических клетках, таких как клетки животных и клетки растений, репликация ДНК происходит в S-фазе интерфазы во время клеточного цикла. Процесс репликации ДНК жизненно важен для роста, восстановления и размножения клеток организмов.

Ключевые выводы

  • Дезоксирибонуклеиновая кислота, широко известная как ДНК, представляет собой нуклеиновую кислоту, которая имеет три основных компонента: сахар дезоксирибозы, фосфат и азотистое основание.
  • Поскольку ДНК содержит генетический материал для организма, важно, чтобы он копировался при делении клетки на дочерние клетки. Процесс копирования ДНК называется репликацией.
  • Репликация включает производство идентичных спиралей ДНК из одной двухцепочечной молекулы ДНК.
  • Ферменты жизненно важны для репликации ДНК, поскольку они катализируют очень важные этапы этого процесса.
  • Общий процесс репликации ДНК чрезвычайно важен как для роста клеток, так и для размножения организмов. Это также жизненно важно в процессе восстановления клеток.

Структура ДНК

ДНК или дезоксирибонуклеиновая кислота - это тип молекулы, известный как нуклеиновая кислота. Он состоит из 5-углеродного дезоксирибозного сахара, фосфата и азотистого основания. Двухцепочечная ДНК состоит из двух спиральных цепей нуклеиновых кислот, скрученных в форму двойной спирали.Такое скручивание позволяет ДНК быть более компактной. Чтобы поместиться в ядре, ДНК упакована в плотно скрученные структуры, называемые хроматином. Хроматин конденсируется с образованием хромосом во время деления клетки. Перед репликацией ДНК хроматин разрыхляется, предоставляя механизмам репликации клеток доступ к цепям ДНК.

Подготовка к репликации

Библиотека научных фотографий / Getty Images

Шаг 1. Формирование репликационной вилки

Прежде чем ДНК сможет реплицироваться, двухцепочечная молекула должна быть «разорвана» на две одноцепочечные.ДНК имеет четыре основания: аденин (A) , тимин (T) , цитозин (C) и гуанин (G) , которые образуют пары между двумя цепями. Аденин соединяется только с тимином, а цитозин связывается только с гуанином. Чтобы раскрутить ДНК, эти взаимодействия между парами оснований должны быть нарушены. Это выполняется ферментом, известным как ДНК геликаза . ДНК-геликаза разрушает водородные связи между парами оснований, разделяя нити в Y-образную форму, известную как репликационная вилка .Эта область будет шаблоном для начала репликации.

ДНК направлена ​​в обеих цепях, что обозначено 5 'и 3' концом. Это обозначение означает, какая боковая группа присоединена к остову ДНК. К 5'-концу присоединена фосфатная (P) группа, а к 3'-концу присоединена гидроксильная (ОН) группа. Эта направленность важна для репликации, поскольку она прогрессирует только в направлении от 5 футов до 3 дюймов. Однако вилка репликации двунаправлена; одна нить ориентирована в направлении от 3 футов до 5 футов (ведущая нить) , а другая - от 5 футов до 3 футов (отстающая нить) .Таким образом, две стороны дублируются двумя разными процессами, чтобы учесть разницу в направлениях.

Начало репликации

Шаг 2: Привязка праймера

Ведущую нить проще всего воспроизвести. После разделения цепей ДНК короткий фрагмент РНК, называемый праймером , связывается с 3'-концом цепи. Праймер всегда связывается в качестве отправной точки для репликации. Праймеры генерируются ферментом ДНК-примазой .

Репликация ДНК: удлинение

ДНК-полимеразы (синий цвет) прикрепляются к ДНК и удлиняют новые цепи, добавляя нуклеотидные основания.

UIG / Getty Images

Шаг 3: удлинение

Ферменты, известные как ДНК-полимеразы , ответственны за создание новой цепи посредством процесса, называемого элонгацией. Существует пять различных известных типов ДНК-полимераз в бактериях и клетках человека. У бактерий, таких как E. coli, , полимераза III, является основным ферментом репликации, а полимеразы I, II, IV и V отвечают за проверку и исправление ошибок.ДНК-полимераза III связывается с цепью на участке праймера и начинает добавлять новые пары оснований, комплементарные цепи во время репликации. В эукариотических клетках полимеразы альфа, дельта и эпсилон являются первичными полимеразами, участвующими в репликации ДНК. Поскольку репликация происходит в направлении от 5 'до 3' на ведущей цепи, вновь сформированная цепь является непрерывной.

Отстающая цепь начинает репликацию путем связывания с несколькими праймерами. Каждый праймер разделяет всего несколько оснований.Затем ДНК-полимераза добавляет фрагменты ДНК, называемые фрагментами Окадзаки , к цепи между праймерами. Этот процесс репликации прерывистый, так как вновь созданные фрагменты разъединены.

Шаг 4: Прекращение действия

После образования как непрерывных, так и прерывистых цепей фермент под названием экзонуклеаза удаляет все праймеры РНК из исходных цепей. Затем эти праймеры заменяют соответствующими основаниями. Другая экзонуклеаза «корректирует» вновь образованную ДНК, чтобы проверить, удалить и заменить любые ошибки.Другой фермент под названием ДНК-лигаза соединяет фрагменты Окадзаки вместе, образуя единую цепь. Концы линейной ДНК представляют проблему, поскольку ДНК-полимераза может добавлять нуклеотиды только в направлении от 5 'к 3'. Концы родительских цепей состоят из повторяющихся последовательностей ДНК, называемых теломерами. Теломеры действуют как защитные колпачки на концах хромосом, чтобы предотвратить слияние соседних хромосом. Особый тип фермента ДНК-полимеразы под названием теломераза катализирует синтез теломерных последовательностей на концах ДНК.После завершения родительская цепь и ее комплементарная цепь ДНК сворачиваются в знакомую форму двойной спирали. В конце концов, при репликации образуются две молекулы ДНК, каждая с одной цепью исходной молекулы и одной новой цепью.

Ферменты репликации

Молекула ДНК-полимеразы.

Cultura / Getty Images

Репликация ДНК не могла бы происходить без ферментов, которые катализируют различные стадии процесса. Ферменты, которые участвуют в процессе репликации эукариотической ДНК, включают:

  • ДНК-геликаза - раскручивает и разделяет двухцепочечную ДНК по мере ее движения по ДНК.Он образует репликационную вилку, разрывая водородные связи между парами нуклеотидов в ДНК.
  • ДНК-примаза - тип РНК-полимеразы, которая генерирует РНК-праймеры. Праймеры - это короткие молекулы РНК, которые действуют как матрицы для начальной точки репликации ДНК.
  • ДНК-полимеразы - синтезируют новые молекулы ДНК путем добавления нуклеотидов к ведущим и отстающим цепям ДНК.
  • Топоизомераза или ДНК-гираза - раскручивает и перематывает нити ДНК, чтобы предотвратить запутывание или суперскручение ДНК.
  • Экзонуклеазы - группа ферментов, удаляющих нуклеотидные основания с конца цепи ДНК.
  • ДНК-лигаза - соединяет фрагменты ДНК вместе, образуя фосфодиэфирные связи между нуклеотидами.

Сводка репликации ДНК

Репликация ДНК.

Фрэнсис Лерой / Getty Images

Репликация ДНК - это производство идентичных спиралей ДНК из одной двухцепочечной молекулы ДНК. Каждая молекула состоит из цепи исходной молекулы и вновь образованной цепи.Перед репликацией ДНК разматывается, и нити разделяются. Формируется репликационная вилка, которая служит шаблоном для репликации. Праймеры связываются с ДНК, и ДНК-полимеразы добавляют новые нуклеотидные последовательности в направлении от 5 'к 3'.

Это добавление непрерывно в ведущей нити и фрагментировано в отстающей нити. После завершения удлинения цепей ДНК цепи проверяются на наличие ошибок, производится ремонт и к концам ДНК добавляются теломерные последовательности.

Источники

  • Рис, Джейн Б., и Нил А. Кэмпбелл. Биология Кэмпбелла . Бенджамин Каммингс, 2011.

Смотри: Что такое двоичное деление?

Какие этапы репликации ДНК

Что такое репликация ДНК

ДНК, сокращенно от дезоксирибонуклеиновой кислоты, представляет собой самовоспроизводящийся материал, который присутствует почти во всех живых организмах в качестве основного компонента хромосом. Это основной носитель генетической информации, присутствующий практически в каждой клетке вашего тела.

Двойная спираль ДНК состоит из двух асимметричных цепей. Каждая цепь состоит из нуклеотидов, выстроенных один за другим, и эти нуклеотиды связаны с соответствующими нуклеотидами на другой цепи, чтобы создать лестничную структуру. ДНК состоит из четырех нуклеотидов - строительных блоков нуклеиновых кислот - которые состоят из азотистого основания, пятиуглеродного сахара (рибозы или дезоксирибозы) и по крайней мере одной фосфатной группы.

Аденин (A), тимин (T), гуанин (G) и цитозин (C) называются нуклеотидами. A и G называются пуринами, а T и C называются пиримидинами. Согласно правилам спаривания оснований, A всегда соединяется с T, а C всегда соединяется с G.

Прежде чем клетка произведет дублирование или деление посредством митоза или мейоза, ДНК должна быть реплицирована, чтобы гарантировать, что каждая новая клетка получит правильное количество хромосом. Этот процесс происходит во всех живых организмах и является основой биологической наследственности.

Репликация ДНК

происходит в несколько этапов, в которых задействованы несколько белков, называемых ферментами репликации, а также РНК.Репликация ДНК жизненно важна для роста, восстановления и размножения клеток в организмах.

Этапы репликации ДНК

Существует три основных этапа репликации ДНК: инициация , удлинение и завершение.

Чтобы соответствовать ядру клетки, ДНК упаковывается в плотно скрученные структуры, называемые хроматином, который перед репликацией разрыхляется, позволяя аппарату репликации клетки получить доступ к цепям ДНК.

Перед тем, как репликация ДНК может начаться, двойную спиральную структуру молекул ДНК необходимо «распаковать».'Геликаза, фермент, является неотъемлемой частью этого процесса, разрывая водородные связи, которые удерживают вместе комплементарные основания ДНК (A с T и C с G). Разделение создает Y-образную форму, называемую репликационной вилкой, и две отдельные цепи ДНК теперь действуют как шаблоны для создания новых цепей ДНК.

Затем белок, связывающий одноцепочечную ДНК (SSB Protein), связывается с теперь уже одноцепочечной ДНК, предотвращая повторное соединение разделяющих цепей.

Две нити двойной спирали ДНК соединены поперечинами, скрученными вокруг.Чтобы это работало, каждая нить ДНК движется в противоположном направлении.

Репликация ведущих и отстающих цепей ДНК. Предоставлено: Genome Research Limited.

Одна из нитей ориентирована в направлении от 3 ’к 5’ (к вилке репликации), это ведущая нить. Другая нить ориентирована в направлении от 5 ’к 3’ (от вилки репликации), это отстающая нить.

Поскольку фермент, осуществляющий репликацию, ДНК-полимераза, функционирует только в направлении от 5 'к 3', это означает, что дочерние цепи синтезируются разными методами, добавляя нуклеотиды один за другим в направлении репликационной вилки, другие могут добавлять нуклеотиды только кусками.Первая цепь, которая реплицирует нуклеотиды один за другим, является ведущей цепью; другая нить, которая копируется кусками, является отстающей нитью.

Обозначения 5 'и 3' означают «пять простых» и «три простых», которые указывают количество атомов углерода в сахарном скелете ДНК. Эти числа указывают на химическую ориентацию от конца до конца, причем числа 5 и 3 представляют пятый и третий атом углерода сахарного кольца соответственно. 5'-углерод имеет присоединенную к нему фосфатную группу, а 3'-углерод - гидроксильную (-ОН) группу.Именно эта асимметрия придает цепи ДНК «направление», позволяя легко связываться между нуклеотидами противоположных цепей.

Важно отметить, что две стороны реплицируются с помощью двух разных процессов, чтобы учесть разницу в направлениях.

Ведущее звено Отстающая нить
Короткий фрагмент РНК, называемый праймером, который продуцируется ферментом под названием праймаза, связывается с концом ведущей цепи в направлении от 5 ’к 3’.Праймер действует как отправная точка для синтеза ДНК.

Ферменты, называемые ДНК-полимеразами, генерируют новые комплементарные нуклеотидные основания (A, C, G и T) и отвечают за создание новой цепи посредством процесса, называемого элонгацией. В эукариотических клетках полимеразы альфа, дельта и эпсилон являются первичными полимеразами, участвующими в репликации ДНК.

Такой вид репликации называется «непрерывным».

Отстающая цепь начинает процесс репликации путем связывания с несколькими праймерами РНК, генерируемыми ферментом праймазой, в различных точках вдоль отстающей цепи.

Куски ДНК, называемые фрагментами Окадзаки, добавляются к отстающей цепи между праймерами также в направлении от 5 ’к 3’.

Этот тип репликации называется «прерывистой», так как фрагменты Окадзаки нужно будет соединить позже.

После образования как непрерывных, так и прерывистых цепей фермент, называемый экзонуклеазой, удаляет все праймеры РНК из исходных цепей. Затем пустоты, на которых был праймер (ы), заполняются еще более комплементарными нуклеотидами.

Другой фермент «корректирует» вновь образованные нити, чтобы убедиться в отсутствии ошибок.

Затем ферментная ДНК-лигаза соединяет фрагменты Окадзаки вместе, образуя единую цепь.

Особый тип фермента ДНК-полимеразы, называемый теломеразой, катализирует синтез теломерных последовательностей на концах ДНК. Теломеры - это участки повторяющихся нуклеотидных последовательностей на каждом конце хроматиды, которые защищают конец хромосомы от разрушения или от слияния с соседними хромосомами.Подумайте о шапках для шнурков. Теломеры также являются биомаркером старения, при этом теломеры укорачиваются с каждым клеточным делением или, другими словами, с возрастом. По мере того как теломеры клетки укорачиваются, она теряет способность нормально функционировать. По сути, более короткие теломеры делают вас более восприимчивыми к ряду заболеваний, таких как рак или сердечно-сосудистые заболевания.

Наконец, родительская цепь и ее комплементарная цепь ДНК скручиваются в знакомую форму двойной спирали. В результате получаются две молекулы ДНК, состоящие из одной новой и одной старой цепочки нуклеотидов.Каждая из этих двух дочерних спиралей является почти точной копией родительской спирали (она не на 100% одинакова из-за мутаций).

Геном человека, то есть полный набор генов, присутствующих в ядре клетки, состоит из 3 миллиардов пар оснований. Примечательно, что нашему биологическому оборудованию требуется очень мало времени, чтобы скопировать что-то столь долгое. Каждая ячейка выполняет весь процесс всего за один час!

Репликация ДНК - Структура - Этапы репликации

Репликация ДНК

, также известная как se ми-консервативная репликация , представляет собой процесс, с помощью которого ДНК существенно удваивается.Это важный процесс, происходящий внутри делящейся клетки.

В этой статье мы кратко рассмотрим структуру ДНК, точные этапы репликации ДНК (инициация, удлинение и завершение) и клинических последствий , которые могут произойти, когда что-то пойдет не так.

Структура ДНК

ДНК состоит из миллионов нуклеотидов. Это молекулы, состоящие из дезоксирибозного сахара с присоединенным к нему фосфатом и основанием (или азотистым основанием).Эти нуклеотиды прикреплены друг к другу цепями через фосфодиэфирные связи с образованием «сахарно-фосфатного остова». Образуется связь между третьим атомом углерода на сахаре дезоксирибозы одного нуклеотида (далее известном как 3 ’) и пятым атомом углерода другого сахара на следующем нуклеотиде (известном как 5’).

Примечание: 3 произносится как «три простых», а 5 »- как« пять простых ».

Две нити проходят в противоположных или антипараллельных направлениях друг к другу.Они прикреплены друг к другу по всей длине цепи через основания на каждом нуклеотиде. Есть 4 различных основания, связанных с ДНК; Цитозин, гуанин, аденин и тимин. В нормальных цепях ДНК цитозин связывается с гуанином, а аденин - с тимином. Две нити вместе образуют двойную спираль.

Рис. 1.0. Структура РНК и ДНК [/ caption]

Этапы репликации ДНК

репликацию ДНК можно представить в виде трех стадий; Начало, удлинение, окончание

Инициирование

Синтез ДНК

инициируется в определенных точках внутри цепи ДНК, известных как « origin », которые являются конкретными кодирующими областями.Эти источники являются мишенями для белков-инициаторов, которые продолжают привлекать больше белков, которые помогают процессу репликации, образуя комплекс репликации вокруг источника ДНК. Существует несколько сайтов происхождения, и когда начинается репликация ДНК, эти сайты обозначаются как r , вилки эпликации .

В репликационном комплексе находится фермент ДНК-геликаза , который раскручивает двойную спираль и обнажает каждую из двух цепей, так что их можно использовать в качестве матрицы для репликации.Он делает это путем гидролиза АТФ, используемого для образования связей между азотистыми основаниями, тем самым разрывая связь, удерживающую две цепи вместе.

ДНК-примаза - еще один фермент, который важен для репликации ДНК. Он синтезирует небольшой праймер РНК , который действует как «пусковой механизм» для ДНК-полимеразы . ДНК-полимераза - это фермент, который в конечном итоге отвечает за создание и расширение новых цепей ДНК.

Удлинение

После того, как ДНК-полимераза прикрепилась к исходному, разархивируйте две нити ДНК (т.е. шаблон цепей), он может начать синтез новой ДНК для соответствия шаблонам. Важно отметить, что ДНК-полимераза способна удлинить праймер только путем добавления свободных нуклеотидов к 3 ’концу .

Один из шаблонов считывается в направлении от 3 ’к 5’, что означает, что новая нить будет сформирована в направлении от 5 ’к 3’ . Эта вновь сформированная нить называется ведущей нитью . Вдоль этой цепи ДНК-примазе необходимо синтезировать только праймер РНК один раз вначале, чтобы инициировать ДНК-полимеразу.Это связано с тем, что ДНК-полимераза способна удлинить новую цепь ДНК, считывая матрицу от 3 'до 5', синтезируя в направлении от 5 'до 3', как указано выше.

Однако другая цепочка-матрица (запаздывающая цепочка ) антипараллельна, и поэтому считывается в направлении от 5 ’к 3’ . Непрерывный синтез ДНК, как в ведущей цепи , должен происходить в направлении от 3 'до 5', что невозможно, поскольку мы не можем добавлять основания к 5 'концу. Вместо этого, когда спираль раскручивается, праймеры РНК добавляются к вновь экспонированным основаниям на запаздывающей цепи , и синтез ДНК происходит фрагментами, , но все еще в направлении от 5 'к 3', как и раньше.Эти фрагменты известны как фрагменты казаки O .

Прекращение

Процесс расширения новых цепей ДНК продолжается до тех пор, пока либо не останется ни одной матрицы ДНК для репликации (т.е. в конце хромосомы), либо две репликационные вилки встретятся, а затем завершатся. Встреча двух вилок репликации не регулируется и происходит случайно по ходу хромосомы.

После завершения синтеза ДНК важно, чтобы вновь синтезированные цепи были связаны и стабилизировались.Что касается отстающей цепи, для этого необходимы два фермента; РНКаза H удаляет праймер РНК, который находится в начале каждого фрагмента Окадзаки, а ДНК-лигаза объединяет фрагменты вместе, чтобы создать одну полную цепь.

Рис. 2.0 - Схематическое изображение репликации ДНК [/ caption]

[старт-клиника]

Клиническая значимость - серповидноклеточная анемия

Серповидноклеточная анемия - это аутосомно-рецессивное заболевание, которое вызывается заменой одного основания , , при котором только одно основание заменяется другим.В некоторых случаях это может привести к «молчащей мутации», при которой не затрагивается весь ген, однако при таких заболеваниях, как серповидноклеточная анемия, это приводит к тому, что цепь кодирует другой белок.

В этом случае основание аденина заменяется на основание тимина в одном из генов, кодирующих гемоглобин; в результате глутаминовая кислота заменяется валином. Когда он транскрибируется в полипептидную цепь, свойства, которыми он обладает, радикально изменяются, поскольку глутаминовая кислота является гидрофильной, а валин гидрофобной.Эта гидрофобная область приводит к тому, что гемоглобин имеет аномальную структуру, которая может вызывать закупорку капилляров, что приводит к ишемии и потенциально некрозу тканей и органов - это известно как вазоокклюзионный кризис .

Эти кризы обычно лечатся различными обезболивающими, включая опиоиды и НПВП, в зависимости от степени тяжести. Переливания красных кровяных телец могут потребоваться в экстренных случаях, например, если закупорка происходит в легких.

Рис. 3.0. Разница в структуре между нормальными эритроцитами и эритроцитами, пораженными серповидно-клеточной анемией. [/ caption]

[окончание клинической]

16.1: Двойная спираль ДНК и ее репликация

Двойная спираль ДНК и ее репликация

Масштаб проблемы

В этом модуле мы обсуждаем репликацию ДНК - одно из ключевых требований к живой системе для регенерации и создания следующего поколения.Давайте сначала кратко рассмотрим масштаб проблемы посредством литературной аналогии.

Геном человека состоит примерно из 6,5 миллиардов пар оснований ДНК, если рассматривать полный диплоидный геном (то есть если считать ДНК, унаследованную от обоих родителей). Шесть целых пять десятых миллиарда выглядит так: 6 500 000 000. Это большое количество. Чтобы лучше понять, что означает это число, представьте, что наша ДНК - это набор письменных инструкций по конструированию одного из нас. Затем по аналогии мы можем сравнить его с другим письменным документом.Для этого примера мы начнем с рассмотрения романа Толстого «Война и мир », романа, который многим известен по его объемному характеру. По данным Википедии, «Война и мир» содержит около 560 000 слов. Вторая письменная работа, с которой многие знакомы, - это семь томов Дж.К. Роулинг Гарри Поттер . Эта работа проверяется на ~ 1 080 000 слов (Ссылочная статистика в Википедии). Если предположить, что длина среднего английского слова составляет пять символов, два литературных произведения равны 2.Длина 8 миллионов и 5,4 миллиона символов соответственно. Таким образом, даже все семь томов «Гарри Поттера» содержат в 1000 раз меньше символов, чем наши собственные геномы. Однако количество персонажей в этих романах намного ближе к количеству нуклеотидов в типичном бактериальном геноме.

А теперь представьте на мгновение разработку машины или механического процесса (не электронного процесса), который отвечает за чтение и копирование этих книг. Или представьте себя копирующим эти тексты.Как быстро ты мог это сделать? Сколько ошибок вы можете совершить? Ожидаете ли вы компромисса между скоростью копирования и точностью? Какие ресурсы нужны для этого процесса? Сколько энергии требуется? А теперь представьте, что вы копируете что-то в 1000 раз больше! Да, и на всякий случай, ваше воображаемое механическое устройство должно выполнять свою работу с текстом шириной ~ 25 Å (т. Е. Шириной 0,0000000025 метра). Для сравнения, типичный десятистрочный шрифт имеет ширину ~ 0,00025 метра, что примерно в 100000 раз больше, чем ширина пары оснований ДНК.

Имея это в виду, стоит отметить, что клетке человека может потребоваться около 24 часов для деления (поэтому репликация ДНК должна быть немного быстрее). Здоровой клетке E. coli может потребоваться всего 20 минут для деления (включая репликацию генома из ~ 4,5 миллионов пар оснований). И человек, и бактерия делают это, обычно совершая достаточно мало ошибок, чтобы последующее поколение оставалось жизнеспособным и узнаваемым. Это должно показаться довольно удивительным! Теперь представьте, что человеческое тело, по оценкам, состоит из ~ 10 триллионов клеток (10 000 000 000 000), и что в нем может быть от двух до десяти раз больше микробных жителей, и это большое деление клеток, которое следует учитывать.

Задача проектирования


Если клетка должна воспроизводиться - ее конечная цель - должна быть создана копия ДНК. Итак, одна четкая постановка проблемы / вопрос - «как клетка может эффективно копировать свою ДНК?» Учитывая приведенную выше аналогию, вот несколько важных подвопросов: Какие химические и физические свойства позволяют копировать ДНК? С какой точностью должна быть скопирована ДНК? С какой скоростью это нужно копировать? Откуда берется энергия для этой задачи и сколько нужно? Откуда «сырье»? Как молекулярные машины, участвующие в этом процессе, соединяют вместе сборку сырья и энергию, необходимую для создания новой молекулы ДНК? Список, конечно, можно продолжать.

В следующем обсуждении и в лекции нам будет интересно начать исследовать, как осуществляется процесс репликации ДНК, не забывая при этом о некоторых основных вопросах. Просматривая материалы для чтения и лекции, старайтесь постоянно помнить об этих и других вопросах, связанных с этим процессом. Используйте эти вопросы как ориентиры для систематизации своих мыслей и постарайтесь найти совпадения между «фактами», которые, как вы думаете, вы должны знать, и ведущими вопросами.

Двойная спираль ДНК

Чтобы создать дополнительный контекст, нам также понадобится немного эмпирически определенных знаний. Возможно, одна из самых известных и популярных особенностей наследственной формы молекулы ДНК состоит в том, что она имеет двойную спиральную третичную структуру. Это относится к 1950-м годам. История этого открытия широко рассказывалась, и подробности выходят за рамки этого текста. Вкратце, Фрэнсису Крику и Джеймсу Уотсону приписывают определение структуры ДНК.Розалинде Франклин теперь также широко приписывают создание критических данных дифракции рентгеновских лучей, которые позволили Уотсону и Крику собрать воедино загадку молекулы ДНК.

Модели структуры ДНК показали, что молекула состоит из двух цепей ковалентно связанных нуклеотидов, которые скручены друг вокруг друга, образуя правую спираль. В каждой цепи нуклеотиды ковалентно связаны с двумя другими нуклеотидами (за исключением самых концов линейной цепи) через фосфодиэфирные связи, которые связывают сахара через 5 'и 3' гидроксильные группы (панель b на рисунке 1).Напомним, что метки 5 'и 3' относятся к атомам углерода в молекуле сахара. Эти сахарные и фосфатные цепи образуют непрерывный набор ковалентных звеньев, которые часто называют «основой» структуры. В линейной молекуле каждая цепь имеет два свободных конца. Один из них называется 5'-концом, потому что несвязанная функциональная группа, которая обычно участвует в соединении нуклеотидов, представляет собой фосфат, связанный с 5'-атомом углерода. Другой конец цепи называется 3'-концом, потому что несвязанная функциональная группа, которая обычно участвует в соединении нуклеотидов, представляет собой гидроксильную группу, связанную с 3'-атомом углерода сахара.Поскольку два конца нити не являются симметричными, это позволяет легко обозначить или описать направление одной нити - можно, например, сказать, что они читают от конца 5 футов до конца 3, чтобы указать, что они «ходьба» по нити, начиная с 5 'конца и двигаясь к 3' концу. Между прочим, это направление (5 'к 3') является условным, используемым большинством биологов. Можно читать в обратном направлении (от 3 'до 5'), если это явно указано. Обнаружено, что две цепи ковалентно связанных нуклеотидов антипараллельны друг другу в двойной спирали; то есть ориентация / направление одной нити противоположно ориентации другой нити (панель b на рисунке 1).Каркас структурно находится «снаружи» двойной спирали, создавая полосу отрицательных зарядов на поверхности. Напротив, азотистые основания каждой из антипараллельных цепей складываются внутри структуры и противостоят друг другу таким образом, что позволяет образовываться водородным связям между уникальными парами пурин / пиримидин (соединение A с T и G с C). Эти конкретные пары называются комплементарными другой, и, таким образом, противоположные нити двойной спирали часто называют друг друга как комплементарные нити .

Дополнительные нити несут избыточную информацию. Из-за строгого химического спаривания, если вы знаете последовательность одной нити, вы обязательно знаете нить ее комплемента. Возьмем, к примеру, последовательность 5′- C A T A T G G G A T G - 3 ′. Обратите внимание на то, как последовательность помечена ориентацией (обозначенной метками 5 'и 3'). Дополнение этой последовательности, записанное в соответствии с соглашением от 5 'к 3', выглядит следующим образом: 5'- C A T C C C A T A T G - 3 '. Если вы не уверены, запишите эти две последовательности друг напротив друга в своих заметках, обязательно записывая их как антипараллельные нити.Обратите внимание, что скручивание двух дополнительных цепей вокруг друг друга приводит к образованию структурных особенностей, называемых большими и малыми бороздками, которые станут более важными, когда мы обсудим связывание белков с ДНК (панель c на рисунке 1).

Большинство инструкторов BIS2A ожидают, что вы узнаете ключевые структурные особенности, изображенные на рисунке ниже, и что вы сможете сами создать базовую фигуру структуры ДНК.

Рисунок 1 .ДНК имеет (а) структуру двойной спирали и (б) фосфодиэфирные связи. (C) большая и малая бороздки являются сайтами связывания ДНК-связывающих белков во время таких процессов, как транскрипция (создание РНК из матрицы ДНК) и репликация.

Примерно в то же время рассматривались три гипотезы о способах репликации ДНК. Модели для репликации были известны как консервативная модель, полуконсервативная модель и дисперсионная модель.

1.Консервативный: консервативная модель репликации постулирует, что каждая целая двухцепочечная молекула может действовать как матрица для синтеза совершенно новой двухцепочечной молекулы. То есть, если после репликации поместить химическую метку на матричную молекулу ДНК, ни одна из этих меток не будет обнаружена на новой копии.
2. Полуконсервативная: эта гипотеза предполагала, что каждая отдельная цепь молекулы ДНК может служить шаблоном для новой цепи, с которой она теперь будет ассоциироваться.в этом случае, если бы химическая метка была помещена на двухцепочечную молекулу ДНК, одна цепь на каждой из копий сохраняла бы метку.
3. Дисперсность: эта модель предполагает, что скопированная двойная спираль представляет собой кусочную комбинацию непрерывных сегментов «старых» и «новых» нитей. Если бы химическая метка была помещена на молекулу ДНК, которая была скопирована с использованием дисперсионного механизма, можно было бы найти дискретные сегменты полученной копии, которые были помечены на обеих цепях, разделенных полностью немечеными частями.

Мезельсон и Шталь решили эту проблему в 1958 году, когда они сообщили о результатах известного теперь эксперимента (описанного в Википедии), который показал, что репликация ДНК является полуконсервативной (рис. 2), где каждая нить используется в качестве шаблона для создания новая прядь. Чтобы узнать больше об этом эксперименте, посмотрите Эксперимент Мезельсона-Шталя.

Рисунок 2 . ДНК имеет антипараллельную структуру двойной спирали, нуклеотидные основания связаны вместе водородными связями, и каждая цепь дополняет другую.ДНК реплицируется полуконсервативным образом, каждая цепь используется в качестве матрицы для новой цепи.

Репликация ДНК

Установив некоторые основные структурные особенности и потребность в полуконсервативном механизме, важно начать понимать кое-что из того, что известно о процессе, и подумать о том, на какие вопросы можно было бы ответить, если они хотят лучше понять, что это такое. продолжается.

Поскольку репликация ДНК - это процесс, мы можем воспользоваться рубрикой энергетической истории, чтобы подумать об этом.Вспомните, что рубрика «Энергетическая история» помогает нам систематически думать о процессах (как вещи переходят из пункта А в пункт Б). В данном случае рассматриваемый процесс представляет собой акт, начинающийся с одной двухцепочечной молекулы ДНК и заканчивающийся двумя двухцепочечными молекулами. Итак, мы зададим множество вопросов: как выглядит система в начале (материя и энергия) репликации? Как материя и энергия передаются в системе и что катализирует передачу? Как выглядит система в конце процесса? Мы также можем задать вопросы относительно конкретных событий, которые ДОЛЖНЫ произойти во время процесса.Например, поскольку ДНК представляет собой длинную молекулу, а иногда и круглую, мы можем задать базовые вопросы, например, где начинается процесс репликации? Где это кончится? Мы также можем задать практические вопросы о процессе, например, что происходит, когда двухцепочечная структура разматывается?

Мы рассматриваем некоторые из этих ключевых вопросов в тексте и в классе и призываем вас сделать то же самое.

Требования к репликации ДНК

Давайте начнем с перечисления некоторых основных функциональных требований к репликации ДНК, которые мы можем вывести, просто подумав о процессе, который должен произойти и / или необходим для репликации.Итак, что нам нужно?

• Мы знаем, что ДНК состоит из нуклеотидов. Если мы собираемся создать новую цепь, нам понадобится источник нуклеотидов.
• Мы можем сделать вывод, что для построения новой цепи ДНК потребуется источник энергии - мы должны попытаться найти его.
• Мы можем сделать вывод, что должен существовать процесс поиска места для начала репликации.
• Мы можем сделать вывод, что существует один или несколько ферментов, которые помогают катализировать процесс репликации.
• Мы также можем сделать вывод, что, поскольку это биохимический процесс, будут сделаны некоторые ошибки.

Обзор структуры нуклеотидов

Напомним некоторые основные структурные особенности нуклеотидных строительных блоков ДНК. Нуклеотиды начинаются как нуклеотидтрифосфаты. Нуклеотид состоит из азотистого основания, дезоксирибозы (пятиуглеродного сахара) и фосфатной группы. Нуклеотид назван в соответствии с его азотистым основанием, пуринами, такими как аденин (A) и гуанин (G), или пиримидинами, такими как цитозин (C) и тимин (T). Вспомните структуры ниже. Обратите внимание, что нуклеотид-аденозинтрифосфат (АТФ) является предшественником дезоксирибонуклеотида (дАТФ), который встроен в ДНК.

Рисунок 3 . Каждый нуклеотид состоит из сахара (рибоза или дезоксирибоза в зависимости от того, образует ли он РНК или ДНК соответственно), фосфатной группы и азотистого основания. Пурины имеют двойную кольцевую структуру с шестичленным кольцом, конденсированным с пятичленным кольцом. Пиримидины меньше по размеру; они имеют единую шестичленную кольцевую структуру. Атомы углерода пятиуглеродного сахара пронумерованы 1 ', 2', 3 ', 4' и 5 '(1' читается как «одно простое число»).Фосфатный остаток присоединен к гидроксильной группе 5'-углерода одного сахара одного нуклеотида и гидроксильной группе 3'-углерода сахара следующего нуклеотида, таким образом образуя 5'-3'-фосфодиэфирную связь.

Инициирование репликации
Где вдоль ДНК репликационный аппарат запускает репликацию ДНК?

Имея миллионы, если не миллиарды, нуклеотидов, которые нужно скопировать, как ДНК-полимераза знает, с чего начать? Неудивительно, что этот процесс оказывается не случайным.Существуют специфические нуклеотидные последовательности, называемые точками начала репликации , вдоль длины ДНК, на которой начинается репликация. Однако, как только этот сайт будет идентифицирован, возникает проблема. Двойная спираль ДНК удерживается вместе за счет взаимодействия стэкинга оснований и водородных связей. Если каждая нить должна считываться и копироваться индивидуально, должен быть какой-то механизм, ответственный за помощь в отделении двух цепочек друг от друга. Энергетически это эндергонический процесс. Откуда берется энергия и как катализируется эта реакция? Основные рассуждения на этом этапе должны привести к гипотезе о том, что, вероятно, задействован белковый катализатор, и этот фермент либо создает новые связи, которые энергетически более выгодны (экзергонические), чем связи, которые он разрывает, И / ИЛИ он может связать использование внешнего источника энергии, чтобы помочь разъединить пряди.

Оказывается, детали этого процесса и задействованные белки различаются в зависимости от конкретного рассматриваемого организма, и многие детали молекулярного уровня еще предстоит полностью понять. Однако есть некоторые общие черты в репликации эукариот, бактерий и архей, и одна из этих особенностей заключается в том, что в репликации ДНК участвуют несколько различных типов белков. Во-первых, белки, обычно называемые «инициаторами», обладают способностью связывать ДНК в точках начала репликации или очень близко к ним.Взаимодействие белков-инициаторов с ДНК помогает дестабилизировать двойную спираль, а также помогает привлекать другие белки, включая фермент под названием ДНК геликаза в ДНК. В этом случае энергия, необходимая для дестабилизации двойной спирали ДНК, по-видимому, происходит от образования новых ассоциаций между ДНК и белками-инициаторами и самими белками. ДНК-геликаза - это мультисубъединичный белок, который важен в процессе репликации, потому что он связывает экзергонический гидролиз АТФ с раскручиванием двойной спирали ДНК.Дополнительные белки должны быть задействованы в инициирующем комплексе (совокупности белков, участвующих в инициации транскрипции). К ним относятся, помимо прочего, дополнительные ферменты, называемые примазой и ДНК-полимеразой . В то время как инициаторы теряются вскоре после инициации репликации, остальные белки работают согласованно, чтобы выполнить процесс репликации ДНК. Этот комплекс ферментов функционирует в Y-образных структурах ДНК, называемых репликационными вилками (рис. 4).Для любого события репликации в каждой точке начала репликации могут быть сформированы две вилки репликации, идущие в обоих направлениях. Множественные источники репликации могут быть обнаружены на хромосомах эукариот и некоторых архей, в то время как геном бактерии E. coli , по-видимому, кодирует один источник репликации.

Примечание: возможное обсуждение

Почему у разных организмов разное количество источников репликации? Какая польза от наличия более одного? Есть ли недостаток в наличии более одного?

Примечание: возможное обсуждение

Учитывая, что должно произойти в начале репликации, можете ли вы использовать логику, чтобы вывести и предложить для обсуждения некоторые потенциальные особенности, которые отличают источники репликации от других сегментов ДНК?

Рисунок 4 . В начале репликации образуется пузырек репликации. Пузырь репликации состоит из двух вилок репликации, каждая из которых движется в противоположных направлениях вдоль ДНК. Понятно, что вилки репликации включают в себя все ферменты, необходимые для репликации , они просто не показаны явно на фигуре, чтобы предоставить место для иллюстрации взаимосвязей между матрицей и новыми цепями ДНК.
Атрибуция: оригинальное изображение команды BIS2A

Удлинение репликации

Расплавление двойной спирали ДНК и сборка комплекса репликации ДНК - это лишь первый шаг в процессе репликации.Теперь действительно нужно начать процесс создания новой пряди. Здесь возникают дополнительные проблемы. Первая очевидная проблема заключается в том, чтобы определить, какая из двух цепей должна быть скопирована на любой вилке репликации (т.е. какая цепь будет служить шаблоном для полуконсервативного синтеза? Являются ли обе цепи равно жизнеспособными альтернативами?). Существует также проблема фактического запуска процесса синтеза новой цепи. Может ли ДНК-полимераза инициировать новую цепь сама по себе? Ответ на последний вопрос, а также некоторые его причины и последствия будут обсуждены позже.Ключевая идея, которую следует отметить на этом этапе, заключается в том, что экспериментально установлено, что ДНК-полимераза НЕ может инициировать синтез цепи сама по себе. Скорее, ДНК-полимераза требует короткого участка двухцепочечной структуры, за которым следует одноцепочечная матрица. Создание короткого олигонуклеотида осуществляется ферментом примазой . Этот белок создает короткий полимер РНК (не ДНК), называемый праймером (они показаны короткими зелеными линиями на рисунках выше и ниже), который может использоваться ДНК-полимеразой для зарождения новой растущей цепи.

В процессе удлинения цепи ДНК-полимераза полимеризует новую ковалентно связанную цепь нуклеотидов ДНК (у бактерий этот специфический фермент может называться ДНК-полимеразой III; у эукариот номенклатура полимеразы более сложна и роли нескольких белки-полимеразы до конца не изучены). Оказывается, одна из прядей предпочтительнее другой, чтобы служить шаблоном. ДНК-полимераза «считывает» цепь матрицы от 3 'до 5' и синтезирует новую цепь в направлении от 5 'до 3'.Гипотезы, объясняющие это универсальное наблюдение, обычно связаны с энергетикой, связанной с добавлением нового нуклеотида, и аргументами, связанными с репарацией ДНК, которые мы вскоре опишем. Поэтому кратко рассмотрим реакцию присоединения одного нуклеотида. Праймер обеспечивает важный 3'-гидроксил, с которого начинается синтез. Следующий дезоксирибонуклеотидтрифосфат входит в сайт связывания ДНК-полимеразы и, как показано на рисунке 5 ниже, ориентируется полимеразой таким образом, что может происходить гидролиз 5'-трифосфата, высвобождая пирофосфат и связывая эту экзергоническую реакцию с синтезом фосфодиэфирная связь между 5'-фосфатом входящего нуклеотида и 3'-гидроксильной группой праймера.Этот процесс можно повторять до тех пор, пока не закончатся дезоксирибонуклеотидтрифосфаты или пока репликационный комплекс не отпадет от ДНК. Фактически, ДНК-полимераза добавляет фосфатную группу (5 ') из поступающего нуклеотида к существующей гидроксильной группе (3') ранее добавленного нуклеотида.

Правильное спаривание оснований или выбор правильного нуклеотида для добавления на каждом этапе достигается за счет структурных ограничений, ощущаемых ДНК-полимеразой и энергетически выгодными водородными связями, образованными между комплементарными нуклеотидами.Этот процесс энергетически управляется гидролизом поступающего 5'-трифосфата и энергетически выгодными взаимодействиями, образованными межнуклеотидными взаимодействиями в растущей двойной спирали (укладка оснований и комплементарные водородные связи спаривания оснований). Обратите внимание, что энергетика добавления нуклеотидов технически не препятствует росту цепи в направлении от 3 'до 5', ключевое отличие в этой схеме состоит в том, что «источником» энергии для синтеза должен быть нуклеотид, уже включенный в растущий цепи, а не нового поступающего нуклеотида (что может быть важным селективным недостатком, обсуждается кратко).После того, как элонгация началась, другая ДНК-полимераза (у бактерий это обычно называется ДНК-полимеразой I) входит, чтобы удалить праймер РНК и синтезировать оставшуюся часть недостающей ДНК.

Как будет обсуждаться более подробно в классе, движение репликационной вилки вызывает наматывание ДНК в обоих направлениях репликации. Другой фермент, потребляющий АТФ, называется топоизомераза , помогает снять этот стресс.

Рисунок 5 .ДНК-полимераза катализирует присоединение 5'-фосфатной группы входящего нуклеотида к 3'-гидроксильной группе предыдущего нуклеотида. Этот процесс создает фосфодиэфирную связь между нуклеотидами при гидролизе фосфоангидридной связи в нуклеотиде.
Источник: http://bio1151.nicerweb.com/Locked/m...h26/elong.html

Примечание: возможное обсуждение

Создайте энергетический рассказ для добавления нуклеотида к полимеру, как показано на рисунке выше.Это будет явной целью обучения некоторых ваших инструкторов BIS2A.

Ведущая и ведомая нить

Вышеупомянутое обсуждение удлинения цепи описывает процесс синтеза новой цепи, если эта цепь синтезируется в том же направлении, что и репликационная вилка, или кажется, что она движется по ДНК. Эта цепь может быть синтезирована непрерывно и называется ведущей цепью . Однако необходимо скопировать обе нити исходной двойной спирали ДНК.Поскольку ДНК-полимераза может синтезировать ДНК только в направлении от 5 'до 3', полимеризация цепи, противоположной ведущей цепи, должна происходить в направлении, противоположном направлению движения геликазы или перед репликационной вилкой. Эта цепь называется отстающей цепью , и из-за геометрических ограничений должна быть синтезирована посредством серии событий праймирования РНК и синтеза ДНК в короткие сегменты, называемые фрагментами Okazaki . Как уже отмечалось, для инициации синтеза каждого фрагмента Окадзаки требуется примаза для синтеза праймера РНК, и каждый из этих праймеров РНК должен быть в конечном итоге удален и заменен нуклеотидами ДНК другой ДНК-полимеразой.Ковалентные связи между каждым из фрагментов Окадзаки не могут быть созданы ДНК-полимеразой и, следовательно, должны быть образованы еще одним ферментом, называемым ДНК лигаза . Геометрию синтеза запаздывающих цепей трудно визуализировать, и она будет рассмотрена в классе.

Рисунок 6 . Отстающая прядь состоит из нескольких сегментов. Вилка репликации показывает ведущую и отстающую нити. Пузырь репликации показывает ведущие и отстающие нити.
BIS2A Team исходное изображение

Прекращение репликации
Теломеры и теломераза

Концы репликации в кольцевых бактериальных хромосомах создают мало практических проблем. Однако концы линейных эукариотических хромосом создают специфическую проблему для репликации ДНК. Поскольку ДНК-полимераза может добавлять нуклеотиды только в одном направлении (от 5 'до 3'), ведущая цепь обеспечивает непрерывный синтез до тех пор, пока не будет достигнут конец хромосомы; однако по мере того, как репликационный комплекс достигает конца отстающей цепи, примазе некуда «приземлиться» и синтезировать праймер РНК, чтобы можно было инициировать синтез отсутствующего фрагмента ДНК отстающей цепи на конце хромосомы. ДНК-полимеразой.Без какого-либо механизма, помогающего заполнить этот пробел, этот конец хромосомы останется неспаренным и будет потерян для нуклеаз. Со временем и через несколько раундов репликации это приведет к тому, что концы линейных хромосом станут все короче, что в конечном итоге поставит под угрозу способность организма выживать. Эти концы линейных хромосом известны как теломеры , , и почти все виды эукариот развили повторяющиеся последовательности, которые не кодируют конкретный ген. Как следствие, эти «некодирующие» теломеры действуют как репликационные буферы и укорачиваются с каждым раундом репликации ДНК вместо критических генов.Например, у человека последовательность из шести пар оснований TTAGGG повторяется от 100 до 1000 раз на конце большинства хромосом. Помимо действия в качестве потенциального буфера, открытие фермента теломеразы помогло понять, как поддерживаются концы хромосом. Теломераза - это фермент, состоящий из белка и РНК. Теломераза прикрепляется к концу хромосомы за счет комплементарного спаривания оснований между РНК-компонентом теломеразы и матрицей ДНК. РНК используется в качестве комплементарной цепи для короткого удлинения ее комплемента.Этот процесс можно повторять много раз. Как только матрица отстающей цепи будет достаточно удлинена теломеразой, примаза создаст праймер, за которым следует ДНК-полимераза, которая теперь может добавлять нуклеотиды, комплементарные концам хромосом. Таким образом, концы хромосом реплицируются.

Рисунок 7 . Концы линейных хромосом поддерживаются действием фермента теломеразы.

Теломераза не активна во взрослых соматических клетках.У взрослых соматических клеток, которые претерпевают клеточное деление, продолжают укорачиваться теломеры. По сути, это означает, что сокращение теломер связано со старением. В 2010 году ученые обнаружили, что теломераза может изменить некоторые возрастные заболевания у мышей, и это может иметь потенциал в регенеративной медицине. 1 мышей с дефицитом теломеразы были использованы в этих исследованиях; у этих мышей наблюдается атрофия тканей, истощение стволовых клеток, отказ системы органов и нарушение реакции на повреждение тканей. Реактивация теломеразы у этих мышей вызвала удлинение теломер, уменьшила повреждение ДНК, обратила вспять нейродегенерацию и улучшила работу семенников, селезенки и кишечника.Таким образом, реактивация теломер может иметь потенциал для лечения возрастных заболеваний у людей.

Различия в скорости репликации ДНК между бактериями и эукариотами Репликация ДНК

чрезвычайно хорошо изучена у бактерий, в первую очередь из-за небольшого размера генома и большого количества доступных вариантов. E. coli имеет 4,6 миллиона пар оснований в одной кольцевой хромосоме, и все они реплицируются примерно за 42 минуты, начиная с единственной точки начала репликации и перемещаясь по хромосоме в обоих направлениях.Это означает, что в секунду добавляется примерно 1000 нуклеотидов. Процесс идет намного быстрее, чем у эукариот. В таблице 1 суммированы различия между бактериальными и эукариотическими репликациями.

Таблица 1 . Различия между прокариотической и эукариотической репликацией

Различия между прокариотической и эукариотической репликацией
Имущество Прокариоты Эукариоты
Источник репликации Одноместный Несколько
Скорость полимеризации на полимеразу 1000 нуклеотидов / с от 50 до 100 нуклеотидов / с
Структура хромосомы Циркуляр линейный
Теломераза Нет Настоящее время

Ссылка на внешний ресурс

Щелкните учебник по репликации ДНК.

Двухцепочечная ДНК - обзор

Восстановление двухцепочечной ДНК является решающим фактором выживания после ионизирующего излучения

Двухцепочечные разрывы ДНК считаются смертельным компонентом повреждения ДНК, вызванного ионизирующим излучением. Одноцепочечные разрывы ДНК, если их не восстановить, могут превратиться в двухцепочечные разрывы, и поэтому их восстановление также имеет решающее значение для выживания человеческих клеток после ионизирующего излучения. Таким образом, неудивительно, что репарация двухцепочечных разрывов ДНК обычно считается основным компонентом репарации ДНК, который влияет на радиационную стойкость / чувствительность.

Продемонстрирована кинетика двухфазного восстановления после воздействия ионизирующего излучения, и математическая модель радиационной стойкости, основанная на линейно-квадратичной формуле, стала стандартом. Первоначальный, очень быстрый компонент репарации ДНК, вероятно, связан с простым и быстродействующим коротким NER участка, в котором быстро выполняется удаление поврежденных оснований и последующее лигирование одноцепочечных разрывов ДНК. Второй компонент восстановления после ионизирующего излучения в настоящее время исследуется, хотя все больше данных подтверждают участие ряда белков и ферментов, которые специфически связываются с концами двухцепочечной ДНК.Эти белки, вероятно, участвуют в репарации разрывов ДНК и служат датчиками двухцепочечных разрывов ДНК, которые посылают сигналы за пределы ядра для взаимодействия с белками, которые контролируют клеточный цикл, стимулируют дополнительные процессы репарации ДНК и / или вызывают апоптотические события. Эти ферменты также неотъемлемо участвуют в механизмах рекомбинации V (D) J в лимфоцитах, поскольку двухцепочечные разрывы ДНК являются важными промежуточными звеньями в процессе производства антител.

Клетки, полученные от мышей с тяжелым наследственным комбинированным иммунодефицитным расстройством (ТКИН), обладают высокой радиочувствительностью.У них также отсутствует способность выполнять рекомбинацию V (D) J, и у них есть общие недостатки в их иммунологических ответах. Эти клетки, однако, не слишком чувствительны к УФ-излучению или монофункциональным алкиляторам, но чрезвычайно чувствительны к низким дозам блеомицина, который вызывает двухцепочечные разрывы ДНК «радиомиметическим» способом. Таким образом, считается, что дефект SCID возникает из-за недостаточности репарации двухцепочечных разрывов ДНК. Генное картирование идентифицировало локус рядом с центромерной областью хромосомы 8 человека, который, как полагают, содержит интактный ген, мутировавший в клетках SCID.Когда эта часть хромосомы 8 человека трансфицируется в клетки мыши SCID, радиационная стойкость и рекомбинация V (D) J восстанавливаются до нормального уровня.

Другие эксперименты продемонстрировали, что аутоантиген Ku, гетеродимер, состоящий из одного белка 70 кДа (т.е. Ku70) и одного белка 80 кДа (т.е. Ku 80), специфически связывает концы двухцепочечной ДНК. Гетеродимер Ku может связываться с широким разнообразием концов ДНК, включая выступы 3'-ДНК, выступы 5'-ДНК, тупые концы ДНК, вилки репликации и структуры петля-стержень.Интересно, что гетеродимеры Ku 70 и Ku 80 не связывают одноцепочечные разрывы ДНК или интактную двухцепочечную ДНК, которая имеет небольшую или не имеет сложной вторичной структуры. Таким образом, гетеродимерный комплекс Ku является отличным кандидатом в качестве общего сенсора двухцепочечных разрывов ДНК. Оба белка Ku связываются один к одному стехиометрически с белком массой 440 кДа, называемым каталитической субъединицей ДНК-PK (рис. 2). Эти три белка составляют холофермент ДНК-зависимой протеинкиназы (ДНК-PK). DNA-PK - это серин / треониновая киназа, расположенная в основном в ядре, которая активна только при связывании с ДНК.Субстраты in vitro ДНК-PK включают многие факторы транскрипции, такие как Sp-1, c-fos, c-myc, c-jun, p53, CTR-l / NF-1, Oct-1, Oct-2. , РНК-полимераза 2, Т-антиген SV40 и сами белки Ku 70/80 кДа. Считается, что фосфорилирование Ku-белков снижает связывание ДНК, тем самым обеспечивая петлю обратной связи для активности холофермента ДНК-PK (рис. 2).

Рис. 2. Роль ДНК-PKcs в репарации разрывов ДНК. Гетеродимерный белковый комплекс Ku 70 – Ku 80 связывается с каждым концом двухцепочечного разрыва ДНК.Концы разрыва помещаются в прямое соседнее положение, чтобы произошла репарация разрыва ДНК. После присоединения ДНК-PKc набирается, и холофермент DNA-PK готов. После ассоциации активность фермента серин / треонин DNA-PK резко возрастает, и затем посредством фосфорилирования активируются несколько ключевых факторов ответа транскрипции. Таким образом, активация ДНК-ПК связывает репарацию ДНК с изменениями транскрипции. Затем измененные ответы транскрипции регулируют развитие клеточного цикла и процессы апоптоза.

Идентифицированы мутантные клетки, дефицитные по различным белкам комплекса Ku. Клетки 5 и 6, чувствительные к рентгеновскому излучению (XRS), дефицитны по Ku 80, клетки SXI дефицитны по Ku 70, а клетки SCID недостаточны по активности белка и фермента DNA-PK cs . Как указывалось ранее, клетки мышей SCID демонстрируют заметную радиационную чувствительность, измеренную с помощью анализов выживаемости, и неспособны выполнять рекомбинацию V (D) J. По сравнению с нормальными клетками, количество двухцепочечных разрывов ДНК, вызванных эквивалентными дозами радиации, одинаково в этих мутантных клетках, но последующая репарация двухцепочечных разрывов ДНК недостаточна.Через час после радиационного воздействия наблюдается двукратная разница в количестве присутствующих разрывов ДНК, а через 2 часа - пятикратная разница, при этом нормальные клетки восстанавливают двухцепочечные разрывы ДНК с большей скоростью, чем клетки SCID. .

Трансфекция кДНК Ku 80 в клетки XRS 5 приводит к восстановлению радиационной устойчивости до почти нормального уровня. Анализ количества разрывов ДНК после ионизирующего излучения показал, что как через 1, так и через 2 часа не было значительной разницы в общем количестве разрывов ДНК по сравнению с нормальными контрольными клетками.Подобные эксперименты по трансфекции с другими мутантными клетками демонстрируют аналогичные результаты. Анализ рекомбинации V (D) J после трансфекции кДНК в эти мутантные клетки показал возвращение рекомбинационной способности.

Самовоспроизводящиеся наноструктуры из ДНК

Реплицирующие сущности. Предоставлено: (c) Чонхун Ким и др. Nature Nanotechnology , DOI: 10.1038 / nnano.2015.87

(Phys.org) - Возможно ли создание самовоспроизводящихся наноматериалов? Это могло быть, если бы мы позаимствовали строительные блоки природы.ДНК - это самовоспроизводящаяся молекула, в которой ее составные части, нуклеотиды, вступают в специфические химические взаимодействия, которые позволяют создавать самособирающиеся структуры. В биологических системах ДНК реплицируется с помощью белков. Однако Чжонхун Ким, Джунвье Ли, Сёго Хамада, Сатоши Мурата и Сунг Ха Парк из Университета Сунгюнкван и Университета Тохоку разработали управляемую самовоспроизводящуюся систему, не требующую белков. Их работа опубликована в Nature Nanotechnology .

Чтобы понять, как работает этот самовоспроизводящийся процесс, важно знать его различные составляющие. Kim et al. разработали два Т-мотива ДНК, r 1 и r 2 , которые представляют собой двухцепочечную ДНК, состоящую из функциональных доменов, обозначенных альфа и бета, и «липких» концов в качестве точек соединения. Они также разработали мотив расширения. Двенадцать единиц мотива r 1 самостоятельно собираются в маленькое кольцо, R 1 , и двенадцать единиц r 2 плюс двенадцать удлиненных мотивов самостоятельно собираются в большее кольцо, R 2 .

Эти компоненты могут быть в двух разных состояниях: «удобренный» и «неоплодотворенный». Удобренные структуры содержат элементы, необходимые для воспроизведения. Оплодотворение происходит, когда одноцепочечный альфа- или бета-домен мотива r 1 или r 2 связывается с цепью, имеющей комплементарный альфа- или бета-домен. Это оставляет однониточный выступ или опору, идущую от кольца или от исходного рисунка. Зацепы указывают на то, что кольцо или мотив оплодотворены.

Эти опоры, отходящие от кольца ДНК, связываются с дополнительными цепями захватчиков. Когда это происходит, гибридная структура, состоящая из опоры и вторгающейся нити, отрывается от начального кольца, и в конечном итоге, когда эти части отламываются из-за миграции ветвей, они самостоятельно собираются в другое кольцо.

Этот процесс продолжается двумя разными путями репликации. Один путь растет в геометрической прогрессии. Другой путь растет согласно последовательности Фибоначчи.Конкретный выбранный путь зависит от того, какие вторгающиеся нити добавляются в систему.

Авторы подтвердили, что популяции колец ДНК росли благодаря этому процессу, опосредованному опорой, с помощью АСМ и исследований оптической плотности. Для исследований AFM они взяли небольшой образец из каждой фазы и определили среднее количество колец, присутствующих в этой фазе. Данные по абсорбции были скорректированы для определения относительной концентрации колец на каждой фазе.

Они также подтвердили, что дочерние кольца были результатом отжига с одноцепочечными опорами исходного кольца, а не результатом самосборки остаточных мотивов ДНК в растворе с использованием гель-электрофореза и извлечения продуктов ДНК из каждой фазы.Отдельные фазы изучали с помощью АСМ, и вторгающиеся нити добавляли к раствору во время каждой из фаз, чтобы увидеть, образовались ли кольца.

Ким и др. продемонстрировали, что наноразмерная саморепликация может происходить с использованием термодинамических свойств опосредованного зацепления смещения цепи и способности мотивов ДНК к самосборке. В этом исследовании синтетические Т-мотивы ДНК самоорганизуются в структуры, которые позволяют протекать последовательным реакциям. Это исследование демонстрирует возможность функционально программируемых самовоспроизводящихся наноструктур.


Общие принципы самосборки ДНК-кирпичей
Дополнительная информация: «Саморепликация колец ДНК» Nature Nanotechnology , DOI: 10.1038 / nnano.2015.87

Аннотация
Биология предоставляет множество примеров самовоспроизводящихся машин, но искусственное создание таких сложных систем остается сложной задачей.В частности, хотя были разработаны простые искусственные самовоспроизводящиеся системы, включая деревянные блоки, магнитные системы, модульные роботы и синтетические молекулярные системы, такие кинематические самовоспроизводящиеся системы редки по сравнению с примерами теоретической клеточной саморепликации. Одна из основных причин этого - сложность, возникающая при попытке включить саморепликацию в физический носитель. В этом отношении ДНК является основным материалом-кандидатом для построения самовоспроизводящихся систем из-за ее способности к самосборке посредством молекулярного распознавания.Здесь мы показываем, что Т-мотивы ДНК, которые самособираются в кольцевые структуры, могут быть сконструированы для саморепликации посредством реакций смещения цепи, опосредованных пальцами ног. Внутренняя конструкция этих колец позволяет контролировать динамику популяции систем. Мы также анализируем схему репликации в универсальных рамках самовоспроизведения и выводим количественный показатель самовоспроизводимости колец.

© 2015 Phys.org

Ссылка : Самовоспроизводящиеся наноструктуры из ДНК (28 мая 2015 г.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *