Рубрика

Прививка r2 adc m: АДСМ – вакцинация против дифтерии и столбняка

Содержание

Детская вакцинация | Клиника Рассвет

Вакцинация — самый надежный и эффективный метод профилактики инфекционных заболеваний. Иммунопрофилактика обеспечивает защиту от инфекций для миллионов людей во всем мире.

Вакцинация детей в России проводится согласно национальному календарю профилактических прививок (НКПП) вакцинами российского и зарубежного производства. Однако, в идеале, лучше рассмотреть возможность иммунопрофилактики в соответствии с рекомендациями международных врачебных ассоциаций.

Вакцины бывают монокомпонентными и многокомпонентными (комбинированными). Монокомпонентные вакцины защищают от одной, какой-то конкретной инфекции, а многокомпонентные сразу от нескольких. При этом не возрастает антигенная нагрузка на организм и не увеличивается частота осложнений. Также с введением многокомпонентной вакцины связано снижение количества болезненных инъекций, что особенно важно для детей.

Важно знать: кроме БЦЖ, ни у одной вакцины нет противопоказаний для одновременного введения с другими вакцинами.  Одновременное введение нескольких вакцин безопасно и не «нагружает иммунитет и организм».

Вакцинация согласно национальному календарю профилактических прививок:

Порядок проведения профилактических прививок согласно НКПП.

Защита ребенка от управляемых инфекций

Идеальный план защиты ребенка от управляемых инфекций составил педиатр клиники Рассвет Сергей Бутрий:

  1. Не менее чем за 3 месяца до беременности женщине необходимо ввести вакцины против кори и краснухи.
  2. Во время беременности женщине необходимо вакцинироваться против гриппа (Инфлювак или Ваксигрип) и коклюша (Адасель), однократно.
  3. Ребенку в роддоме должны ввести первую дозу (V1) против гепатита В и БЦЖм.
  4. В 1 месяц — вторую дозу (V2) против гепатита В.
  5. В 2 месяца — V1 Превенар 13 + V1 РотаТек.
  6. В 3 месяца — V1 Пентаксим (АаКДС + ИПВ + ХИБ) + V2 РотаТек.
  7. В 4,5 месяца — V2 Пентаксим (АаКДС + ИПВ + ХИБ) + V3 РотаТек + V2 Превенар 13.
  8. В 6 месяцев — V3 Инфанрикс Гекса (АаКДС + ИПВ + ВГВ + ХИБ) + V3 Превенар 13 (по российскому календарю третья вакцинирующая доза от пневмококка не нужна, в развитых странах вводится трехкратно).
  9. В 9 месяцев — V1 Менактра.
  10. В 12 месяцев проводится проба Манту, через 3 дня оценивается и вводится V2 Менактра + V Приорикс Тетра (или по отдельности дивакцина корь + паротит, вакцина против краснухи, вакцина против ветряной оспы Варилрикс).
  11. В 1 год 3 месяца вводится R Превенар 13 + V2 Варилрикс + V1 Аваксим 80 или Хаврикс 720.
  12. В 1 год и 6 месяцев — R Пентаксим (АаКДС + ИПВ + ХИБ).
  13. В 1 год и 9 месяцев — R2 БиВак Полио + V2 Аваксим 80 или Хаврикс 720.
  14. Далее — до 6 лет — проводятся только ежегодные пробы Манту, ребенка нужно прививать против гриппа осенью (оптимально в сентябре-октябре), с 6 месяцев жизни, в первую осень двукратно, затем каждый год однократно. Также необходимо подумать о прививке против клещевого энцефалита (Клещ-Э-Вак или ФСМЕ Иммун Джуниор) — вводятся две дозы вакцины с минимальным интервалом в месяц перед первым сезоном, одна перед вторым сезоном и далее раз в три года по одной.
  15. В 6 лет вводится R дивакцина корь + паротит + R вакцина против краснухи.
  16. В 6,5 лет — R2 Адасель или R2 АДС-м + R1 Менактра.
  17. В 9 лет — V1 Гардасил или Церварикс.
  18. В 9 лет 6 месяцев — V2 Гардасил или Церварикс.
  19. В 14 лет — R3 АДС-м + R3 БиВак Полио + R2 Менактра.
  20. До 18 лет проводятся ежегодные пробы Манту и вакцинация против гриппа.

С иммунопрофилактикой связано много мифов и суеверий, в основном они транслируют «непоправимый вред для организма». Конечно же, это не так. Благодаря вакцинации детей и взрослых значительно снижается уровень предотвратимых заболеваний, а распространенность некоторых из них (например, полиомиелита) уже удалось свести к минимуму.

Часто родителям, вакцинирующим своих детей, приходится сталкиваться с т. н. ложными медицинскими отводами. Многие врачи считают легкую простуду, проявления аллергии и пищевой непереносимости показателями для переноса сроков вакцинации. Доказательная медицинская практика показывает, что действительным противопоказанием для своевременной вакцинации можно считать только острое проявление заболеваний среднего и тяжелого течения. Истинными пожизненными или долгосрочными противопоказаниями являются сильная реакция на введение предыдущей вакцины (и другие, содержащие тот же самый аллерген) и иммунодефицитные состояния (справедливо только для живых вакцин). То же самое касается и недоношенных детей — ожидание подвергает их высокому риску заражения инфекциями.

Лучше всего делать прививки вовремя, но в большинстве случаев существует возможность наверстать упущенное.

Если по каким-то причинам, вы не делали прививок ребенку или выбились из графика, для составления догоняющего графика вакцинации запишитесь на консультацию к педиатру или иммунологу Рассвета.

Вакцинация защитит вашего ребенка от множества инфекций, способствующих возникновению серьезных заболеваний, — некоторые из них плохо поддаются лечению и существенно снижают качество жизни.

Рутинная вакцинация помогает остановить глобальное распространение инфекционных заболеваний в общей популяции и косвенно (за счет коллективного иммунитета) защищает людей, которым по каким-то причинам противопоказано введение вакцин (ослабленный иммунитет из-за лечения, иммунодефицитные состояния и пр.).

Вакцины не являются причиной аутизма, не ослабляют иммунитет, в них не содержатся опасные для здоровья компоненты, перед выходом на рынок каждая вакцина проходит многоэтапную проверку.

После введения вакцины могут наблюдаться незначительные нежелательные явления: отек и покраснение кожи в месте инъекции, небольшое повышение температуры и легкая слабость в течение 1-2 суток. Критические осложнения возникают крайне редко, о них необходимо незамедлительно сообщить врачу.

Инфекционные заболевания можно легко предотвратить с помощью своевременной иммунопрофилактики. Преимущества вакцинации перевешивают ее риски, это доказано многочисленными исследованиями.


Прививка от дифтерии

Варианты вакцин

Вакцины против дифтерии производятся на основе дифтерийного анатоксина, являющегося модифицированным бактериальным токсином, который индуцирует защитный антитоксин.Прививка для профилактики дифтерии представляет собой анатоксин, адсорбированный на алюминия гидроксиде. Дифтерийный анатоксин выпускается также в комбинации со столбнячным анатоксином (прививки АДС, АДС-м) и коклюшной вакциной (цельноклеточной – АКДС, Бубо-М, Бубо-Кок; и бесклеточной, или ацеллюлярной – Инфанрикс, Пентаксим, Тетраксим, Инфанрикс Пента, ИнфанриксГекса). Профилактические прививки позволяют создать длительный и напряжённый антитоксический иммунитет от дифтерии.

Прививка АКДС состоит из смеси корпускулярной коклюшной вакцины, дифтерийного и столбнячного анатоксинов. АДС-анатоксин представляет собой очищенные и адсорбированные дифтерийный и столбнячный анатоксины. АДС-М-анатоксин отличается от АДС уменьшенным содержанием антигенов — в одной прививочной дозе (0,5 мл) содержится 5 ЛФ (единица измерения активности компонентов) дифтерийного анатоксина и 5 ЕС (единица измерения активности компонентов) столбнячного анатоксина (для сравнения, в 0,5 мл прививки АДС содержится 30 ЛФ дифтерийного анатоксина и 20 ЕС столбнячного анатоксина).

Все вакцины для профилактики дифтерии, столбняка и коклюша являются инактивированными (убитыми), то есть они не содержат ничего живого. Известно, что отдельные антигены в чистом виде и инактивированные вакцины уступают по эффективности живым вакцинам. В этой связи в качестве усилителя (т.н. адъюванта) прививки против дифтерии, столбняка, коклюша (и ряда других инфекций) используется гидроокись алюминия. Смысл использования этого вещества заключается в усилении воспалительной реакции в месте введения вакцин и, как следствие, интенсификации иммунных реакций и увеличении эффективности прививки в целом.

Принципы и цели вакцинации

Дифтерия – крайне опасное своими осложнениями заболевание, для ее профилактики необходима вакцинация. Производство вакцин – сложный многоступенчатый процесс. Дифтерийный анатоксин получают из токсина, продуцируемого дифтерийным микробом. Микроорганизмы культивируют в жидкой питательной среде, в которую они выделяют токсин. Полученную среду тщательно освобождают от микробных клеток, а затем обрабатывают, чтобы полностью обезвредить токсин, сохранив только его иммунизирующую активность. Дифтерийный анатоксин контролируется по нескольким показателям (приняты ВОЗ в 1965 г.): прежде всего, на безопасность, то есть полноту обезвреживания токсина. Этот показатель проверяют на чувствительных животных, вводя им дозу, в 50-100 раз превышающую дозу для человека, что позволяет выявить следовые количества недообезвреженного токсина. После теста на безопасность его проверяют на возможность возврата токсических свойств. С этой целью очищенный анатоксин инкубируют в течение шести недель при разных температурных режимах, а затем опять проводят контрольный тест на животных.

Дозировка — у детей с 3-х месяцев до 4 лет - три прививки от дифтерии по 0,5 мл с интервалом 6 недель, с последующей ревакцинацией через 12 месяцев после третьей прививки; у детей старше 4 лет и взрослых – две прививки от дифтерии по 0,5 мл с интервалом 4-6 недель с последующей ревакцинацией через 9-12 месяцев.

После проведения серии первичной иммунизации средняя продолжительность защиты от дифтерии составляет около 10 лет. Далеко не все знают, что во взрослом возрасте показана ревакцинация ассоциированным дифтерийно-столбнячным анатоксином с уменьшенным содержанием антигена (АДС-м) каждые 10 лет.

Эффективность вакцин

Введение в 1994 г. массовой иммунизации населения страны против дифтерии с повторной ревакцинацией взрослых в 2003-2004 гг. позволило обеспечить достаточную специфическую защиту населения от этой инфекции. В совокупности с многолетним надзором это привело к снижению заболеваемости дифтерией в России с 26,8 в 1994 г. до 0,01 на 100 тыс. населения в 2009-2011 гг. В течение периода 1980-2000 гг. общее число зарегистрированных случаев дифтерии было снижено более чем на 90%.

Все компоненты АКДС-вакцин способны формировать иммунитет практически у 100% привитых.

Побочные реакции

После введения адсорбированных препаратов (внутримышечно или подкожно) на месте инъекции может некоторое время сохраняться небольшое уплотнение, которое не опасно для организма.

Прививки АКДС являются наиболее реактогенными, «тяжелыми» вакцинами детского возраста. В среднем побочные реакции встречаются у трети привитых, причем не на каждую прививку. Пик частоты реакций отмечается, как правило, на третье и четвертое введения вакцины, что совпадает с пиковыми показателями выработки иммунитета. Они проявляются умеренным повышением температуры тела, легким недомоганием в течение суток после вакцинации. Возможны также покраснение, припухание, болезненность в месте инъекции, редко бывают быстропроходящие эфемерные высыпания. Реакции в месте введения прививки от дифтерии в целом отмечаются у 15-25% привитых: покраснение (1-2%) и отечность (1-2%), вызванные иммунным воспалением в месте введения вакцины и действием адъюванта. Боль в месте укола (вероятность около 15%, проявляется тем, что при движениях ребенок «бережет» ножку и плачет) также является следствием воспалительной реакции.

Общие реакции на прививку от дифтерии в среднем отмечаются у 20% привитых: повышение температуры тела (до 30%), прочие (беспокойство или, наоборот, заторможенность, рвота, понос, нарушения аппетита). Как правило, все побочные реакции на АКДС-вакцины развиваются не позднее 24 (72) часов после прививки, длятся не более 24 (48) часов и не требуют лечения.

Риск поствакцинальных осложнений

Как и на введение любой другой вакцины, в редких случаях возможны аллергические реакции на компоненты АКДС-вакцины. Эти осложнения связаны не со свойствами прививки, а с количеством вспомогательных веществ в конкретных препаратах, наличием у ребенка аллергии к ним и, в части случаев, несоблюдением правил вакцинации. Показателен тот факт, что, согласно статистике поствакцинальных осложнений в США, даже тяжелые аллергические реакции на АКДС-вакцины не привели к тяжелым последствиям ни в одном случае с 1978 года, с учетом того, что за этот период было сделано около 80 млн прививок против дифтерии. К вероятным специфическим осложнениям на прививки АКДС можно отнести неврологические осложнения, которые крайне редки. Как предполагается, они могут быть вызваны тем, что токсины коклюшной палочки (даже инактивированной) в комбинированных вакцинах имеют свойство раздражать, у крайне небольшой части восприимчивых детей, мозговые оболочки.

Редкими проявлениями неврологических осложнений на прививку от дифтерии могут быть: судороги без повышения температуры – 0,3-90 на 100 тыс. прививок, осложнения в виде энцефалопатии – менее 1 случая на 300 тысяч привитых. В настоящее время в мире судороги без повышения температуры не считают осложнением на прививку. Исследования, проведённые в Великобритании в 1960-1970 гг. свидетельствуют об одинаковой частоте развития судорог у привитых и непривитых детей. При этом первые проявления таких заболеваний как эпилепсия, органическое поражение головного мозга могут проявляться в виде судорог в возрасте 3-4 месяцев, когда начинают проводить вакцинацию, и связаны с прививкой только временным фактором.

Противопоказания

Помимо общих противопоказаний к вакцинации против дифтерии, таких как острое заболевание, аллергия к компонентам прививок и тяжелый иммунодефицит (при котором формирование иммунитета невозможно), АКДС-вакцины временно или абсолютно противопоказаны в случае, если у ребенка имеется прогрессирующая патология нервной системы, либо отмечались судороги без повышения температуры (афебрильные). В этом случае дети прививаются вакциной от дифтерии без коклюшного компонента (прививка АДС). Временными и относительными противопоказаниями являются обострение хронических заболеваний (прививки можно проводить вне обострений), недавно перенесенная острая респираторная инфекция (ОРИ) (прививки против дифтерии можно проводить сразу после выздоровления). Следует заметить, что в США легкая ОРИ не является противопоказанием, и прививки могут быть проведены, в том числе, на фоне незначительного повышения температуры, кашля, насморка. Также противопоказанием является развитие сильных общих и местных реакций на предшествующее введение АКДС прививки (повышение температуры выше 40 С, отек и гиперемия в месте введения вакцины свыше 8 см в диаметре).

Когда прививать?

Курс первичной вакцинации против дифтерии проводят детям с 3-месячного возраста троекратно, с интервалом 45 дней. Первая ревакцинация проводится прививкой АКДС через 12 месяцев после 3-й вакцинации, вторая ревакцинация — с 7 лет АДС-М-анатоксином, третья — в 14 лет, и далее взрослым– каждые 10 лет АДС-М-анатоксином.

Национальный календарь профилактических прививок

Вид прививки Возраст ребенка Примечания
Первая вакцинация против вирусного гепатита В Проводится новорожденному в первые сутки жизни Инъекция делается в роддоме внутримышечно в плечо или бедро ребенка. Требуется письменное согласие на вакцинацию матери.
Вакцинация против туберкулеза (БЦЖ-М) Проводится новорожденному на 3-7 день жизни Инъекция делается в роддоме внутрикожно в левое плечо. Требуется письменное согласие на вакцинацию матери. Другие прививки можно проводить не ранее чем через 1 месяц после БЦЖ.
Вторая вакцинация против вирусного гепатита В Проводится ребенку после 1 месяца от рождения Если сроки были сдвинуты, то через 1 месяц после первой. Прививка делается в детской поликлинике после осмотра педиатра и письменного согласия матери. Инъекция проводится внутримышечно в плечо или бедро ребенка.
Первая вакцинация против дифтерии, коклюша, столбняка (АКДС) Проводится ребенку в 3 месяца Прививка делается в детской поликлинике после осмотра педиатра и письменного согласия матери. Ребенок должен быть совершенно здоров и после болезни должен пройти месяц. Инъекция проводится внутримышечно в плечо, бедро или под лопатку. Детям до года чаще всего делают в бедро.
Первая вакцинация против полиомиелита Проводится ребенку в 3 месяца Прививка делается в детской поликлинике после осмотра педиатра и письменного согласия матери. Вакцина против полиомиелита делается в один день с АКДС. Инактивированная полиомиелитная вакцина вводится подкожно под лопатку или в плечо, а также может быть введена внутримышечно в бедро. Вакцины закупаются за рубежом, поэтому заблаговременно узнавайте о ее наличие в поликлинике. Вакцинация производится трехкратно с интервалом в 45 дней.
Первая вакцинация против гемофильной инфекции Проводится ребенку в 3 месяца Прививка делается в детской поликлинике после осмотра педиатра и письменного согласия матери. Вакцина против гемофильной инфекции делается в один день с АКДС и вакциной против полиомиелита. Вводится внутримышечно в бедро или плечо, но при этом это должна быть другая рука или нога, в которую еще не производились инъекции.
Вторая вакцинация против дифтерии, коклюша, столбняка (АКДС) Проводится ребенку в 4,5 месяца Прививка делается в детской поликлинике после осмотра педиатра и письменного согласия матери через 45 дней после первой вакцинации. Инъекция вводится внутримышечно в плечо, бедро или под лопатку.
Вторая вакцинация против полиомиелита Проводится ребенку в 4,5 месяца Прививка делается в детской поликлинике после осмотра педиатра и письменного согласия матери. Вакцинация от полиомиелита выполняется в один день с АКДС через 45 дней после первой вакцинации. Инъекция выполняется подкожно в плечо, под лопатку или внутримышечно в бедро.
Вторая вакцинация против гемофильной инфекции Проводится ребенку в 4,5 месяца Прививка делается в детской поликлинике после осмотра педиатра и письменного согласия матери. Вакцинация от гемофильной инфекции проводится в один день с АКДС через 45 дней после первой вакцинации. Инъекция выполняется внутримышечно в бедро или плечо, но при этом это должна быть другая рука или нога, в которую еще не производились инъекции.
Третья вакцинация против дифтерии, коклюша, столбняка (АКДС) Проводится ребенку в 6 месяцев Прививка делается в детской поликлинике после осмотра педиатра и письменного согласия матери через 45 дней после второй вакцинации. Инъекция вводится внутримышечно в плечо, бедро или под лопатку.
Третья вакцинация против полиомиелита Проводится ребенку в 6 месяцев Прививка делается в детской поликлинике после осмотра педиатра и письменного согласия матери. Вакцинация от полиомиелита выполняется в один день с АКДС через 45 дней после второй вакцинации. Живая оральная полиомиелитная вакцина закапывается в рот на лимфоидную ткань глотки. Пить и есть в течение часа строго запрещается.
Третья вакцинация против гемофильной инфекции Проводится ребенку в 6 месяцев Прививка делается в детской поликлинике после осмотра педиатра и письменного согласия матери. Вакцинация проводится в один день с АКДС через 45 дней после второй вакцинации. Инъекция проводится внутримышечно в бедро или плечо.
Третья вакцинация против вирусного гепатита В Проводится ребенку в 6 месяцев Прививка проводится в детской поликлинике после осмотра педиатра и письменного согласия матери через 6 месяцев после первой прививки. Инъекция проводится внутримышечно в плечо или бедро.
Вакцинация против кори, эпидемического паротита, краснухи (КПК) Проводится ребенку в 1 год Прививка проводится в детской поликлинике после осмотра педиатра и письменного согласия матери. Инъекция вводится подкожно в бедро или плечо.
Первая ревакцинация против дифтерии, коклюша, столбняка Проводится ребенку в 18 месяцев Прививка проводится в детской поликлинике после осмотра педиатра и письменного согласия матери через год после законченой вакцинации. Способы введения те же.
Первая ревакцинация против полиомиелита Проводится ребенку в 18 месяцев Прививка проводится в детской поликлинике после осмотра педиатра и письменного согласия матери совместно с АКДС. Живая оральная полиомиелитная вакцина закапывается в рот на лимфоидную ткань глотки. Пить и есть в течение часа строго запрещается.
Вторая ревакцинация против полиомиелита Проводится ребенку в 20 месяцев Прививка проводится в детской поликлинике после осмотра педиатра и письменного согласия матери через 2 месяца после первой ревакцинации живой оральной полиомиелитной вакциной.
Ревакцинация против кори, краснухи, эпидемического паротита Проводится ребенку в 6 лет Вакцинация проводится в детской поликлинике после осмотра педиатра и письменного согласия матери через 6 месяцев после вакцинации. Основным условием применения вакцины является отсутствие в анамнезе перенесенных заболеваний: кори, краснухи, эпидемического паротита до 6 лет. Способ введения тот же.
Вторая ревакцинация против дифтерии, столбняка (АДС) Проводится ребенку в 6-7 лет Вакцинация проводится в детской поликлинике после осмотра педиатра и письменного согласия матери через 5 лет после первой ревакцинации. Инъекция вводится внутримышечно под лопатку.
Ревакцинация против туберкулеза Проводится ребенку в 7 лет Вакцинация проводится в детской поликлинике после осмотра педиатра и письменного согласия матери при отрицательной реакции Манту. Инъекция вводится внутрикожно в левое плечо.
Третья ревакцинация против дифтерии, столбняка Проводится подростку в 14 лет Вакцинация проводится в детской поликлинике после осмотра педиатра и письменного согласия матери через 7 лет после второй ревакцинации. Инъекция вводится внутримышечно под лопатку.
Третья ревакцинация против полиомиелита Проводится подростку в 14 лет Вакцинация проводится в детской поликлинике после осмотра педиатра и письменного согласия матери через 12 лет 2 месяца после второй ревакцинации. Живая оральная полиомиелитная вакцина закапывается на поверхность небных миндалин, чтобы сформировался иммунитет. Нельзя пить и есть в течение часа после прививки.

Дифтерии и столняка |

Вакцинация против дифтерии

Дифтерия – это опасное инфекционное заболевание, которое вызывается микроорганизмом рода коринебактерии (бацилла Лёффлера).

Заболевание передается преимущественно воздушно-капельным путем и поражает органы дыхательной системы, кожу, глаза, нервную и даже половую систему. Повышение температуры, боль в горле, слабость, отек тканей шеи, увеличение многих групп лимфоузлов и появление налета на миндалинах  в виде пленок – далеко не все прелести дифтерии.

 

Столбняк – патология крайне тяжело поддается терапии, вакцинация считается оптимальным методом для борьбы с ней. Когда делают прививку от столбняка? С 14-16 лет вакцинация против болезни каждые 10 лет. Ограничений по возрасту нет, что связано с ростом продолжительности жизни и широким распространением болезни. При нарушении графика иммунизации или при возникновении экстренной ситуации могут делать внеочередную прививку от столбняка.

Делать прививку от дифтерии и столбняка взрослым? – да, ведь заболевание опасно своими осложнениями.

  1.  Развиваются заболевания нервной системы, чаще в виде параличей дыхательных путей, конечностей, мышц шеи и голосовых связок.
  2. Воспаление мышцы сердца или миокардит.
  3. Может наступить смертельный исход вследствие паралича дыхательной мускулатуры.

За последние десятилетия количество случаев заболеваемости дифтерией удалось значительно снизить благодаря вакцинации. Единичные случаи дифтерии чаще встречаются в коллективах, где есть не привитые.

Осложнения при отсутствии вакцинации от столбняка

  1. Наличие долго незаживающих ран, гнойные нарывы на коже
  2. Появление ран на кожном покрове или слизистой оболочке в результате обморожений, травм, сильных ожогов
  3. Укус животного
  4. Грядущая операция (если ранее прививку АКДС и АДС-м не делали)

График вакцинации от дифтерии для взрослых

В случае, если человек получил все прививки в положенное время – то вакцину вводят начиная с 14-16-летнего возраста каждые 10 лет однократно.

Если человек пропустил вакцинацию более 10 лет, то иммунизация против дифтерии и столбняка проводится по схеме 0-1-6, то есть интервал между первой и второй вакцинацией 30-45 дней, ревакцинация через 6 месяцев от первой прививки, далее через каждые 10 лет проводится однократная ревакцинация.

Все данные о необходимых прививках содержаться в прививочной карте в медицинской книжке. Их составляет и ведет участковая служба в поликлинике. Вызывает на прием и вакцинацию чаще всего участковая медсестра.

Вакцинация против дифтерии и столбняка входят в обязательные прививки согласно национальному календарю профилактических прививок. Приказу МЗ РФ от 21.03.2014г. “Об утверждении национального календаря профилактических прививок и профилактических прививок по эпидемическим показаниям”.

10 ответов на вопросы о вакцинации от дифтерии

Комаровский: «Корь покажется сладкой ягодкой на тортике, а вот тортик — это дифтерия»Про вероятную дифтерию заговорили даже некоторые большие начальники. Общество с изумлением узнало, что прививаться от дифтерии надобно не только детям, но и взрослым. Поскольку начальники ничего конкретного не говорят, а у меня по сотне писем в день на тему «как мне быть» — отвечаю на основные вопросы и разъясняю основные непонятности. Вопросы «где что есть?» и «что почем?» — это, уж простите, не ко мне.

10 ОТВЕТОВ НА ВОПРОСЫ ПРО ВАКЦИНАЦИЮ ВЗРОСЛЫХ ОТ ДИФТЕРИИ

1. Вакцины для детей и взрослых — разные. Во «взрослых» вакцинах доза (количество вещества, что должно вызвать иммунитет) меньше — как правило, в два раза. Ими прививают не только взрослых, но и детей «не совсем раннего возраста» — некоторые вакцины, например АДС-М, применяют для иммунизации людей старше 7 лет, другие, например «Бустрикс», — старше 4 лет.

2. Буква «М» в названии вакцины АДС-М как раз и указывает на то, что в ней содержится уменьшенная доза. А еще возможны такие написания: «DT» — вакцина от дифтерии и столбняка, «Td» — маленькая буква «d» в названии означает в два раза уменьшенную дозу.

3. Вакцины для взрослых «только от дифтерии» на практике не применяются. Реально используются либо дифтерия+столбняк (DT), либо дифтерия+столбняк+коклюш (DTP).

4. Как надо прививать взрослых от дифтерии по правилам? Вот так: начинают в детстве — 3 дозы в первый год жизни, по 1 дозе в 1,5 года, 6 и 16 лет. Затем каждые 10 лет — в 26, 36, 46 и т. д.

5. Ученые всего мира продолжают спорить, и предмет спора выглядит так: «каждые 10 лет надо прививаться от дифтерии и столбняка или все-таки каждые 10 лет надо прививаться от дифтерии, столбняка и коклюша?». Вопрос о целесообразности вакцинации от дифтерии раз в 10 лет не стоит в принципе — надо, надо однозначно!

6. Совет: если у вас есть возможность купить вакцину для взрослых с коклюшным компонентом — настоятельно рекомендую привиться и от коклюша, особенно если в ближайшие годы вы планируете заводить детей. Вакцины для профилактики коклюша бывают цельноклеточные и дополнительно очищенные, т. н. «ацеллюлярные». После возраста 7 лет рекомендуется применять только ацеллюлярные вакцины. Про буквы: «DTР» — вакцина от дифтерии, столбняка и коклюша; «DTаР» — вакцина от дифтерии, столбняка и коклюша, но коклюш ацеллюлярный; «Tdap» — вакцина для взрослых от дифтерии, столбняка и коклюша, коклюш ацеллюлярный, уменьшенная доза коклюша и дифтерии — оптимальный вариант, рекомендуемый читателям старше 7 лет (из того, что есть на рынке, этому сочетанию букв соответствуют «Boostrix» и «Adacel»).

7. Вопрос: «Что делать, если правильно привиты в детстве, но пропустили необходимые вакцинации (в 26, 36, 46 и т.д.)?» Ответ: получить 1 дозу вакцины вне зависимости от того, 36 вам или 56 лет.

8. Вопрос: «Что делать, если в детстве не прививались, или привиты неправильно, или не знаем — привиты или нет?» Ответ: получить три дозы — сначала первая доза, через месяц — вторая, через 6 месяцев после второй — третья.

9. Дополнительная вакцинация от коклюша, дифтерии и столбняка обязательна для беременных. То есть вопрос не в том, «можно ли беременным»! Именно беременным нужно в первую очередь!

10. Комбинированная вакцина (дифтерия+столбняк+коклюш — Tdap) вводится однократно при каждой беременности во 2-м или 3-м триместре (оптимально — на сроке 26–37 недель). В любом случае вакцинацию следует завершить не менее чем за 2 недели до предполагаемой даты родов.

в каком возрасте ее делают, побочные эффекты, противопоказания

Прививка АДС-м – это частный вариант АКДС. Но в ней нет компонента от коклюша. Сегодня АДС-м используется для ревакцинаций в целях активизации и продления иммунитета, приобретенного ранее.

В каком же возрасте делают прививку АДС-м? Она используется для взрослых и детей, которым исполнилось 4 года. Это объясняется тем, что для данных возрастных категорий коклюш не так страшен, как для грудничков. С 4-5 летнего возраста он протекает в легкой форме, а вероятность смертельного исхода низка.

Столбняк и дифтерия – опасные инфекции, которые могут поразить абсолютно всех людей, если они не привиты. Столбняком можно заразиться путем попадания возбудителя в любую открытую рану, например, во время отдыха на природе, при проведении огородных работ. Вакцина формирует иммунитет к этим заболеваниям, но со временем он слабеет. Важно не пропускать ревакцинации и, тем более, не отказываться от них.

Для кого подходит вакцина?

АДС-м имеет широкий спектр применения. Она показана людям, которые подлежат вакцинации против дифтерии и столбняка каждые десять лет. А также используется в тех случаях, когда у детей обнаружена непереносимость АДС и АКДС. В составе АДС-м половинная доза дифтерийных и столбнячных анатоксинов, но ее достаточно для того, чтобы поддержать и активизировать уже приобретенный иммунитет.

Сегодня доступна отечественная и импортная вакцины. Последняя реже вызывает нежелательные реакции организма. АДС-м может быть дивалентной комбинированной или одновалентной – отдельно применяется против столбняка и дифтерии.

В чем преимущества перед препаратами АД и АС?

АДС-м называют бивалентной, так как она содержит компоненты против двух инфекций. Многие родители ошибочно полагают, что моновалентные вакцины лучше и легче переносятся детским организмом. На самом деле, чтобы получить поливалентные препараты, все компоненты должны быть биологически чистыми, поэтому ответ организма на них намного мягче.

Нельзя сбрасывать со счетов еще одно преимущество – не придется делать несколько уколов. При этом все балластные вещества, входящие в состав вакцины, попадают в организм только один раз. Если использовать моновалентные препараты, то их количество увеличивается в разы.

Прививка взрослым

Ревакцинацию нужно делать в возрасте 14-16 лет. Ее эффективность сохраняется ближайшие десять лет. После этого опять необходимо сделать ревакцинацию, чтобы поддерживать иммунитет на должном уровне.

Следующие прививки делаются по такому графику:

  • 24 – 26 лет;
  • 34 – 36 лет;
  • 44 – 46 лет;
  • 54 – 56 лет;
  • и далее по графику.

АДС-м детям

Зная расшифровку и сроки прививки АДС-м, становится понятно, что, как правило, до 6 лет детям принято ставить прививку АКДС. Но иногда их организм отторгает эту вакцину, что проявляется в аллергических реакциях и других побочных эффектах, которые бывают очень тяжелыми. В этом случае врач принимает решение применять АДС-м. Это обусловлено тем, что зачастую именно коклюшный компонент вызывает реакции.

Чтобы сформировался иммунитет, дозы анатоксинов должны быть довольно большими, иначе инфекционные заболевания будут протекать в тяжелой степени. Если и щадящая вакцина вызывает отеки, покраснения, воспаления в месте инъекции, то данные об этом должны быть внесены в медицинскую карту ребенка. Вакцинация детей проводится в 3, 4,5 и 6 месяцев, а также в 3 месяца вводят препарат против гемофильной инфекции. Чтобы закрепить эффект, в 1,5 года добавляют бустерную дозу.

Для ревакцинации используют меньшую дозу, так как первичный иммунитет уже сформировался. В дальнейшем прививки у детей негативный ответ организма вызывают намного реже, как так вакцина хорошо переносится.

Прививка и беременность

При беременности прививку не делают. После плановой дозы женщина должна предохраняться в течение месяца. Только после того, как эти сроки пройдут, можно планировать малыша. Вакцина может оказать неблагоприятное влияние на плод.

Если дата плановой прививки попадает в период беременности, то нужно дождаться родов, и только потом делать ревакцинацию. Перед этим обязательно необходимо получить разрешение врача на эту процедуру.

Если женщина поставила прививку, а через некоторое время узнала о своей беременности, то прерывать ее нет смысла. Но нужно тщательно наблюдаться у врача и следить за тем, чтобы у плода не было пороков развития. Если будут выявлены серьезные проблемы, то только после этого стоит обсуждать со специалистом целесообразность прерывания.

Что такое прививка R2 и R3?

Расшифровка АДС-м выглядит следующим образом: адсорбированная вакцина против дифтерии и столбняка в малых дозах. Что же это такое – прививка r2 АДС-м? Ревакцинация под номером 2 обозначается r2. Это значит, что она вводится не в первый раз и это вторая плановая ревакцинация. Она необходима для того, чтобы продлить иммунитет.

Ревакцинация под номером 3 обозначается r3. Это очередная прививка – третья плановая. Ее делают в 14 – 16 лет. Все последующие нужно проводить каждые десять лет, шифруются они соответственно: r4, r5 и далее.

Инструкция по введению вакцины

Препарат нужно вводить стерильным одноразовым инструментом, нельзя мешать несколько вакцин одновременно.

Важно проконтролировать, чтобы препарат был не простроченный, правильно хранился, не замораживался. Если в ампуле вакцины очень много, значит, там есть консервант – соединение ртути.

Нужно знать, куда вводится препарат. Прививка делается только внутримышечно: в бедро, плечо или лопатку. Если не разобраться, куда же делают прививку АДС-м и поставить ее в ягодицу, то это может привести к повреждению седалищного нерва. Процедуру лучше проводить на голодный желудок. После необходимо пить много жидкости и не переедать.

Противопоказания и последствия

Побочные эффекты бывают редко, но о них нужно знать. Реакции могут иметь разную степень выраженности:

  • повышается температура;
  • появляются покраснения, уплотнения;
  • болевые ощущения;
  • тошнота, рвота или диарея.

Если все симптомы проходят через некоторое время, то беспокоиться не стоит.

Необходимо обратиться к врачу, если не исчезают побочные эффекты от прививки АДС-м, резко ухудшается самочувствие, присутствует жар, озноб, нарушается двигательная активность конечностей.

Противопоказаний к прививке АДС-м немного. Нельзя ее делать, если наблюдается иммунодефицит, аллергия на компоненты препарата, заболевания в острой форме. Если есть другие противопоказания, их определит врач.

Некоторые люди являются противниками вакцинации и отказываются от прививок. Но это очень опрометчивое решение. Последствия заболеваний намного страшнее, чем возможные побочные эффекты от вакцины. Поэтому хорошо подумайте перед тем, как писать отказ от прививок.

Материалы, размещённые на данной странице, носят информационный характер и предназначены для образовательных целей. Посетители сайта не должны использовать их в качестве медицинских рекомендаций. Определение диагноза и выбор методики лечения остаётся исключительной прерогативой вашего лечащего врача.

расшифровка, что это такое и от чего, куда делают взрослым, инструкция по применению, вакцина детям, r2 и r3 (rv2) в 14 лет, побочные эффекты, реакция у детей 6 и 7, Анатоксин осложнения, ревакцинация противопоказания, когда и сколько раз, можно ли мочить, состав р2

На чтение 8 мин. Просмотров 3.2k.

Вакцинация является одним из самых эффективных способов профилактики тяжелых инфекционных заболеваний. Прививка АДСМ — это простая процедура, которая используется для ревакцинаций взрослых и детей старше 4 лет от дифтерии и столбняка. От вакцинации можно отказаться, поэтому родителям необходимо знать обо всех особенностях данной процедуры и возможных рисках для ребенка.

От чего эта вакцина

Дифтерия и столбняк — тяжелые бактериальные заболевания, которые не всегда поддаются лечению с помощью антибиотиков. Единственный способ снизить риск заражения и облегчить течение болезни — своевременная вакцинация.

Анатоксин дифтерийно-столбнячный в малых дозах вводится и взрослым пациентам, и детям для снижения риска заражения инфекционными заболеваниями. Инъекция АДСМ, расшифровка которой представляет собой аббревиатуру точного назначения вакцины, используется для профилактики заражения дифтерией и столбняком.

Дифтерия передается воздушно-капельным путем и имеет высокую степень возможного заражения при контакте с больным.

Столбняк является смертельно опасным заболеванием, при котором высок риск летального исхода. Заражение чаще происходит при попадании возбудителя инфекции в рану или на поврежденную слизистую.

Вакцина АДСМ предназначена для ревакцинации детей и взрослых. Прививка помогает продлить действие иммунитета, сформированного в результате введения вакцины АКДС. Лекарство можно применять людям любого возраста. Замена препарата рекомендована пациентам, имеющим негативную реакцию на коклюшный компонент.

До 6 лет прививка не может сформировать иммунитет от тяжелых инфекций. Детский организм должен адаптироваться к анатоксинам АДС, поэтому препарат вводится большими дозами. Для выработки антигенов к возбудителям инфекционных болезней необходимо провопить повторную вакцинацию.

Прививка АДСМ от столбняка и дифтерии может проводиться детям и в возрасте до 4 лет, если есть противопоказания к введению коклюшного компонента.

АДСМ — это прививка, которая входит в число рекомендованных, но не обязательных. Перед каждой вакцинацией родители несовершеннолетних детей дают свое согласие или отказываются от проведения процедуры. Однако следует учесть, что последствия отказа могут быть опасны для здоровья и жизни.

Состав

Инъекция для прививки АДС содержит анатоксины — обработанные особым методом столбнячные и дифтерийные вещества. Благодаря специальной очистке анатоксины не наносят повреждения тканям, но способствуют выработке стойкого иммунитета к возбудителям инфекций.

Содержание раствора АДС-М: анатоксин дифтерийный — 5 флокулирующих единиц и анатоксин столбнячный — 5 связывающих единиц.

Состав вакцины АДСМ отличается малой дозой активного анатоксина. Форма выпуска — ампулы объемом 0,5 и 1 мл. Бивалентная инъекция против 2 инфекций помогает избежать заражения и способствует лучшему усвоению препарата. Очищенный раствор лучше воспринимается организмом и редко вызывает тяжелые реакции.

В чем разница между АДС и АДС-М

Существует несколько видов вакцин, которые применяются для профилактики инфекционных заболеваний. АДС-М анатоксин — прививка против дифтерии и столбняка, которую назначают детям с 3-летнего возраста. Вакцина не содержит инактивированных коклюшных бактерий, поэтому может применяться для прививания детей до 6 лет, имеющих противопоказания к АКДС.

Прививка АДС-М является аналогом АДС и назначается детям старше 6 лет и для ревакцинации. Единственная разница данных вакцин состоит в количестве анатоксинов. Маркировка «М» свидетельствует о том, что в растворе содержится малая доза дифтерийного анатоксина.

Когда делается и сколько раз

Сроки проведения вакцинации зависят от наличия или отсутствия прививки АКДС, которую вводят ребенку в младенческом возрасте. Если вакцинация малыша проводилась, ревакцинация АДС проводится согласно общему графику.

Детский календарь прививок и схема:

  1. В 6 детям делают r2 АДС-М — вторую ревакцинацию. Перед проведением процедуры ребенка обязательно осматривает педиатр. Если есть противопоказания или другие причины для освобождения от прививки, дети вакцинируются позже после полного выздоровления.
  2. АДСМ в 7 лет является второй ревакцинацией. Эту же прививку могут делать детям на год раньше. Время проведения профилактической процедуры подбирается с учетом поступления ребенка в школу. Дополнительная ревакцинация может проводиться детям раньше или позже, если в этом есть особая необходимость.
  3. По достижении четырнадцати лет проводится повторная прививка r2 АДСМ. Третья по графику ревакцинация проводится в период с 14 до 16 лет. Промежуток между прививками составляет 8-10 лет. Плановая вакцинация помогает укрепить иммунитет, который через 7 лет после постановки прививки уже начинает снижаться.
  4. В 16-18 лет ребенку вводят r3 АДС-М — третью ревакцинацию. Процедура касается ослабленных детей и тех, чей режим прививок был нарушен.
  5. Врач-иммунолог проводит осмотр подростка, и только после этого выдает разрешение на проведение процедуры. Если график был нарушен из-за противопоказаний, вакцинации возобновляются после снятия медотвода.

Прививку r3 АДСМ могут ставить детям в 14 лет, если вторая ревакцинация проводилась в возрасте 4 лет. После вакцинации могут наблюдаться побочные реакции, которые проходят через 1-2 суток. Тяжелые симптомы, вызванные прививкой, возникают у 0,2% привитых людей.

Плановая схема:

  • курс из 3 прививок с интервалом в 1,5 месяца в возрасте 3, 4, 5 и 6 месяцев;
  • 18 месяцев первая ревакцинация;
  • детям в 6 лет прививка r2;
  • вакцинация rv3-м в 14 лет или в 18 лет.

АДСМ взрослым. Согласно графику, установленному Министерством здравоохранения, взрослым людям делают прививку каждые 10 лет до возраста 66 лет. Часто прививка делается без предоставления документальных сведений о прошлых вакцинациях. В этом случае для людей из категории непривитых составляется новый график:

  • дважды вакцина АДС-М с промежутком не менее 30 дней;
  • ревакцинация rv2 осуществляется через полгода.

Терапевты рекомендуют проводить иммунизацию регулярно каждые 10 лет все последующие годы. От того, когда была сделана вторая прививка АДСМ взрослому, будут зависеть сроки последующих ревакцинаций.

Противопоказания

Перед вакцинацией ребенка или взрослого необходимо выявить наличие противопоказаний. Чтобы избежать побочных эффектов и тяжелых осложнений, процедура приводится только после осмотра пациента.

Какие по Вашему мнению наиболее важные факторы при выборе медицинского учреждения?Poll Options are limited because JavaScript is disabled in your browser.
  • Доверие к врачу 72%, 2113 голосов

    2113 голосов 72%

    2113 голосов - 72% из всех голосов

  • Современное оборудование 14%, 421 голос

    421 голос 14%

    421 голос - 14% из всех голосов

  • Близкое расположение к дому 5%, 140 голосов

    140 голосов 5%

    140 голосов - 5% из всех голосов

  • Советы знакомых 4%, 126 голосов

    126 голосов 4%

    126 голосов - 4% из всех голосов

  • Стоимость услуг 4%, 116 голосов

    116 голосов 4%

    116 голосов - 4% из всех голосов

  • Реклама 1%, 23 голоса

    23 голоса 1%

    23 голоса - 1% из всех голосов

Всего голосов: 2939

04.11.2019

×

Вы или с вашего IP уже голосовали.

Основными противопоказаниями к прививке АДСМ являются:

  • обострения хронических заболеваний;
  • острое течение любых болезней;
  • слабая иммунная система;
  • непереносимость компонентов;
  • аллергия, диатез у детей;
  • сильная негативная реакция на прошлую вакцинацию.

Противопоказания для взрослых:

  1. Беременность.
  2. Аллергия на любой из компонентов вакцины.
  3. Иммунодефицит.

Прививка АДСМ по инструкции должна соответствовать правилам. Если процедура проводится детям, врач изучает карточку ребенка и опрашивает родителей. После этого принимается решение о возможности проведения прививки.

В течение 3 дней после вакцинации врачи не рекомендуют пить алкоголь. Организм пациента ослаблен, поэтому спиртосодержащие напитки могут привести к развитию заболевания.

Куда делают

Для активации защитного механизма вакцина должна поступить непосредственно в кровь пациента, поэтому прививка ставится только внутримышечно. Места укола могут быть различными и выбираются в зависимости от возраста и телосложения человека:

Малышам до 3 лет, у которых мускулатура не развита, прививку АДСМ делают в верхнюю часть бедра.
Детям старшего возраста инъекция вводится в плечо, т.к. мышечный каркас уже хорошо развит.
В редких случаях прививки ставят под лопатку. Это место подходит тем пациентам, у которых есть лишний вес и жировая прослойка перекрывает доступ к мышцам.

В инструкции по применению вакцины АДС указано, что введение препарата в ягодичную мышцу запрещено. Это связано с тем, что средство может попасть в подкожно-жировую клетчатку, и ее эффективность снизится.

После вакцинации

Чтобы минимизировать негативную реакцию на прививку АДСМ в виде побочных эффектов и осложнений, необходимо придерживаться простых правил:

  1. Нельзя трогать и растирать место укола.
  2. В течение 30 минут необходимо находиться в медицинском учреждении.
  3. При необходимости попросить врача снять болевой синдром с помощью льда или обезболивающего средства.

Можно ли мочить

После постановки прививок АДС-М можно принимать водные процедуры.

Вода не оказывает негативного воздействия на организм, поэтому после вакцинации можно мыться и можно мочить место укола.

Можно ли пить алкоголь

Чтобы избежать негативного влияния вакцинации, следует отказаться от употребления спиртного за несколько дней до проведения процедуры. После следует подождать еще 3-4 дня, чтобы организм смог восстановить иммунную систему. После прививки АДСМ пить алкоголь можно не раньше чем через неделю.

Если употреблять алкоголь до вакцинации, негативные реакции могут возрасти.

На фоне употребления спиртосодержащих напитков место укола может отекать и опухать.

Попадание алкоголя в кровь может спровоцировать аллергию и усилить болевой синдром.

Какие могут быть осложнения

Вакцина редко вызывает негативные побочные эффекты у здоровых пациентов. Реакция организма является нормой и свидетельствует о начале защитного процесса. В течение 2-3 дней симптомы проходят без осложнений и других негативных последствий.

Реакция на АДСМ и побочные действия у взрослых и детей могут быть разной тяжести. К ним относятся одинаковые симптомы, но отличаются степенью выраженности. В легкой форме повышается температура тела до 37°C, в тяжелой форме до 39°C. Обе реакции не будут являться признаками болезни или патологии, поэтому нет необходимости обращения к врачу.

Побочные эффекты:

  • болит место укола;
  • прививка опухла;
  • боль может сопровождаться небольшим отеком.

После инъекции АДСМ у детей могут наблюдаться расстройства желудка, рвота, потеря аппетита. У детей 6 лет после ревакцинации может наблюдаться слабость, заторможенность, нарушение подвижности рук.

Нельзя греть место укола. Теплые компрессы могут спровоцировать нагноение. Снять болевой синдром можно с помощью холодной воды, льда или примочки.

Осложнения:

  • аллергия;
  • крапивница;
  • анафилактический шок;
  • энцефалит;
  • менингит.

Реакция на вакцину проявляется в течение первых 24 часов после укола. Если симптомы, побочные эффекты проявляются на 4-5 день, следует обратиться к врачу.

Произошла ошибка при настройке пользовательского файла cookie

Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


Настройка вашего браузера для приема файлов cookie

Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файлы cookie.
  • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
  • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

Как правило, в файлах cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

(PDF) Структура β-лактамазы ADC-1 класса C расширенного спектра из Acinetobacter baumannii

, субстрат этого фермента, но действовал как ингибитор с K

i

1,7 мМ. Увеличение значений MIC для азтреонама в присутствии ADC-1

могло быть результатом секвестрации этого антибиотика

ферментом, как было продемонстрировано для мутанта

-лактамазы TEM-1, дефицитного по деацилированию. с цефтазидимом

(Antunes et al., 2011).

4. Выводы

Результаты теста на чувствительность к антибиотикам

демонстрируют, что ADC-1 является подлинным ферментом расширенного спектра класса C

, способным придавать устойчивость к цефалоспоринам третьего поколения

, широко используемым для лечение серьезных

бактериальных инфекций. Сравнение структурной информации

, представленной здесь для ADC-1, с кристаллическими структурами

-лактамаз различных классов показывает, что основной детерминант расширенного профиля подложки ADC-1 включает

удаления три остатка в петле R2 и последующие

приводят к увеличению активного сайта ADC-1.Это позволяет ферменту

вмещать объемные боковые цепи R2 цефалоспоринов расширенного спектра

. Мутации, делеции и вставки

в петлю R2 также, по-видимому, важны для повышения активности

лоспоринов цефа-

третьего поколения в других -лактамазах класса C (Jacoby, 2009), что составляет

демонстрирует ключевую роль, которую эта петля играет в активности

этого семейства ферментов.

Части этого исследования были выполнены в Стэнфордском источнике синхротронного излучения

(SSRL), дирекции

SLAC National Accelerator Laboratory и в офисе

Science User Facility, работающем для Департамента США

Energy Office of Наука Стэнфордского университета.Программа структурной молекулярной биологии SSRL

поддерживается Управлением биологических и экологических исследований Министерства энергетики США

, а

Национальным институтом здравоохранения, Национальным институтом общих медицинских наук

(включая P41GM103393) и Национальным центром

. для исследовательских ресурсов (P41RR001209).

Ссылки

Adams, P. D. et al. (2010). Acta Cryst. D66, 213–221.

Альтшул, С. Ф., Гиш, В., Миллер, В., Майерс, Э.В. и Липман, Д. Дж.

(1990). J. Mol. Биол. 215, 403–410.

Альтшул, С. Ф., Мэдден, Т. Л., Ша

Эффер, А. А., Чжан, Дж., Чжан, З.,

Миллер, В. и Липман, Д. Дж. (1997). Nucleic Acids Res. 25, 3389–3402.

Эмблер, Р.П., Колсон, AFW, Fre

` re, J.-M., Ghuysen, J.-M., Joris,

B., Forsman, M., Levesque, RC, Tiraby, G. И Уэйли С.Г. (1991).

Biochem. J. 276, 269–270.

Антунес, Н.Т., Фразе, Х., Тот, М., Мобашери, С., Вакуленко, С. Б.

(2011). Биохимия, 50, 6387–6395.

Банерджи С., Пипер У., Кападиа Г., Паннелл Л. К. и Герцберг О.

(1998). Биохимия, 37, 3286–3296.

Бидл, Б. М. и Шойчет, Б. К. (2002). Противомикробный. Агенты

Chemother. 46, 3978–3980.

Бидл, Б. М., Трехан, И., Фосиа, П. Дж. И Шойчет, Б. К. (2002).

Структура, 10, 413–424.

Берман, Х.М., Вестбрук, Дж., Фен, З., Гиллиланд, Г., Бхат, Т. Н.,

Вайссиг, Х., Шиндялов, И. Н. и Борн, П. Е. (2000). Nucleic Acids

Res. 28, 235–242.

Blizzard, T.A. et al. (2010). Биоорг. Med. Chem. Lett. 20, 918–921.

Богертс, П., Кузон, Г., Наас, Т., Бораинг, К., Деплано, А., Лиссоар,

,

Б., Нордманн, П., Глупчински, Ю. (2008). Противомикробный. Агенты

Chemother. 52, 4205–4206.

Bou, G., Cervero

´, G., Domı

´nguez, M. A., Quereda, C. & Martı

´nez-

Beltra

´n, J. (2000). J. Clin. Microbiol. 38, 3299–3305.

Боу, Г. и Марты

´nez-Beltra

´n, J. (2000). Противомикробный. Агенты

Chemother. 44, 428–432.

Браун С. и Эмис С. (2006). J. Antimicrob. Chemother. 57, 1–3.

Chen, H. et al. (2011). Биоорг. Med. Chem. Lett. 21, 4267–4270.

Чен, В. Б., Арендалл, В. Б., Хедд, Дж. Дж., Киди, Д. А., Иммормино,

Р. М., Капрал, Дж. Дж., Мюррей, Л. У., Ричардсон, Дж. С. и Ричардсон,

Д. К. (2010). Acta Cryst. D66, 12–21.

Чен Ю., Макрейнольдс А. и Шойчет Б. К. (2009). Protein Sci. 18,

662–669.

Кларк Р. Б. (1996). J. Antimicrob. Chemother. 45, 245–251.

Институт клинических и лабораторных стандартов (2009 г.). Методы

Тесты на чувствительность к противомикробным препаратам при разведении для бактерий, которые растут

в аэробных условиях; Утвержденный стандарт - восьмое издание, M07-A8.Уэйн:

Институт клинических и лабораторных стандартов.

Коэльо, Дж., Вудфорд, Н., Тертон, Дж. И Ливермор, Д. М. (2004). J.

Hosp. Заразить. 58, 167–169.

Кричлоу, Г. В., Кузин, А. П., Нукага, М., Маяма, К., Савай, Т. и

Нокс, Дж. Р. (1999). Биохимия, 38, 10256–10261.

Кричлоу, Г. В., Нукага, М., Доппалапуди, В. Р., Буйнак, Дж. Д. &

Нокс, Дж. Р. (2001). Биохимия, 40, 6233–6239.

ДеЛано, W.Л. (2002). PyMOL. http://www.pymol.org.

Dubus, A., Ledent, P., Lamotte-Brasseur, J. & Fre

`re, J.-M. (1996).

Proteins, 25, 473–485.

Эмсли П. и Коутан К. (2004). Acta Cryst. D60, 2126–2132.

Эванс, П. (2006). Acta Cryst. D62, 72–82.

Ферна

Индес-Куэнка, Ф., Марты

Инез-Марты

Инез, Л., Конехо, М. К., Аяла,

Дж. А., Переа, Э. Дж. И Паскуаль, А. (2003). J. Antimicrob.Chemother.

51, 565–574.

Фразе, Х., Ши, К., Тестеро, С.А., Мобашери, С., Вакуленко, С. Б.

(2009). J. Biol. Chem. 284, 29509–29513.

Гастайгер Э., Гаттикер А., Хугланд К., Ивани И., Аппель Р. Д. и

Байрох А. (2003). Nucleic Acids Res. 31, 3784–3788.

Големи Д., Мавейро Л., Вакуленко С., Самама Ж.-П. &

Mobashery, S. (2001). Proc. Natl Acad. Sci. США, 98, 14280–14285.

Худжер, К.М., Хамза, Н.С., Худжер, А.М., Перес, Ф., Хельфанд, М.С.,

Бетель, ЧР, Томсон, Дж. М., Андерсон, В. Э., Барлоу, М., Райс,

LB, Теновер, Ф. С. и Бономо , РА (2005). Противомикробный. Агенты

Chemother. 49, 2941–2948.

Джейкоби, Г. А. (2009). Clin. Microbiol. Ред. 22, 161–182.

Кабш В. (2010). Acta Cryst. D66, 125–132.

Kim, J. Y., Jung, H. I., An, Y. J., Lee, J. H., Kim, S. J., Jeong, S. H., Lee,

K. J., Suh, P.-Г., Ли, Х.-С., Ли, С.Х. и Ча, С.-С. (2006). Мол.

Microbiol. 60, 907–916.

Нокс, Дж. Р., Моус, П. К. и Фрер, Ж.-М. (1996). Chem. Биол. 3,

937–947.

Криссинель, Э. и Хенрик, К. (2004). Acta Cryst. D60, 2256–2268.

Лахири, С. Д., Мангани, С., Дюран-Ревиль, Т., Бенвенути, М., Де

Лука, Ф., Саньял, Г. и Докье, Ж.-Д. (2013). Противомикробный. Агенты

Chemother. 57, 2496–2505.

Ласковски, Р.A., MacArthur, M. W., Moss, D. S. & Thornton, J. M.

(1993). J. Appl. Cryst. 26, 283–291.

Лобковский, Э., Биллингс, Э. М., Моус, П. К., Рахил, Дж., Пратт, Р. Ф. и

Нокс, Дж. Р. (1994). Биохимия, 33, 6762–6772.

Ли, С.-Х., Ли, Дж.-Дж., Ли, Дж.-Дж., Ву, X., Селенге, Б. и Квон, Д. Б.

(2013). ICAAC 2013 Abstracts, Abstract C1-1585. Вашингтон:

Американское общество микробиологии.

Мэтьюз, Б. У. (1968).J. Mol. Биол. 33, 491–497.

Michaux, C., Massant, J., Kerff, F., Fre

`re, J.-M., Docquier, J.-D.,

Vandenberghe, I., Samyn, B., Pierrard , А., Феллер, Г., Шарлье, П.,

Ван Бьюмен, Дж. И Воутерс, Дж. (2008). FEBS J. 275, 1687–1697.

Муршудов Г. Н., Скуба

´k, П., Лебедев А. А., Панну Н. С., Штайнер,

Р. А., Николлс Р. А., Винн М. Д., Лонг Ф. и Вагин А. А. (2011).

Acta Cryst. D67, 355–367.

исследовательские работы

770 Bhattacharya et al. ADC-1 Acta Cryst. (2014). D70, 760–771

электронная перепечатка

(PDF) Структура ADC-68, новой гидролизующей карбапенем β-лактамазы класса C расширенного спектра, выделенной из Acinetobacter baumannii

R1 и R2 субсайтов. Соответственно, конформация С-петли

может напрямую влиять на геометрию активных центров как R1

, так и субсайтов R2 одновременно и важна для расширенного спектра субстратов

-лактамаз.

Структура ядра имипенема была более линейной, чем у свернутой U-образной формы цефалоспоринов

. Подобно структурам, связанным со спорином цефало-

,-лактамное кольцо имипенема также было расщеплено

, и карбонильная группа расщепленного-лактамного кольца

была связана с каталитическим остатком серина. Более короткая цепь-гидроксиэтильной группы

находилась в положении R

1

в структуре -лактама ядра

. Более длинная иминометиламиногруппа

, содержащая цепь в положении R

2

, была связана с субсайтом R2

(рис.7г). Более короткая часть имипенема R

1

занимала

подсайта R1 рядом с правой стороной-петли и не взаимодействовала

с C-петлей и центральной-петлей. Более длинная часть R

2

была в основном связана в подсайте R2, что было близко к

в позиции C-петли. Соответственно, карбапенемы могут быть более

чувствительны к геометрии субсайта R2, чем цефалоспорины.

4. Заключение

Мы обнаружили новую-лактамазу ADC-68 из A.baumannii

D015, устойчивый к карбапенемам, а также к цефалоспоринам расширенного спектра

. ADC-68 является первой cESBL и

карбапенемазой среди-лактамаз класса C, которая кодируется хромосомным геном

. Хотя три плазмиды

, относящиеся к-лактамазам класса C (CMY-2, ACT-1 и CMY-10)

, показали карбапенемазную активность (Mammeri et al., 2010; Kim

et al., 2006), ADC- ферменты типа (за исключением ADC-68)

не проявляли гидролитической активности против карбапенемов, таких как

имипенем, меропенем и эртапенем.Эти кинетические данные

согласуются с определенными МПК, которые выявили наличие устойчивости к карбапенему

.

Структура ADC-68 показала стабильную, широко открытую конформацию в субсайте R2 через прямую C-петлю с B8 и B9

, а также открытие R2-петли из-за ее трех-амино- acid

, которая важна как для cESBL, так и для активности карбапенемазы

. Структура ADC-1 выявила нестабильную конформацию С-петли

, которая могла ингибировать связывание

имипенема или других карбапенемов в большей степени, чем цефалоспорины.

Эта работа была поддержана исследовательскими грантами Программы национальных исследовательских лабораторий

через Национальный исследовательский фонд Кореи

(NRF), финансируемый Министерством

науки, ИКТ и планирования будущего (№ 2011-0027928).

Программа Центра морских и экстремальных исследований генома

, финансируемая Министерством океанов и рыболовства Республики

Корея и руководителем группы инновационных исследований и разработок

провинции Гуандун, Китайская Народная Республика.

Ссылки

Афзал-Шах, М. и Ливермор, Д. М. (1998). J. Antimicrob.

Chemother. 41, 576–577.

Бартон Б. М., Хардинг Г. П. и Зуккарелли А. Дж. (1995). Анальный.

Biochem. 226, 235–240.

Бидл, Б. М. и Шойчет, Б. К. (2002). Противомикробный. Агенты

Chemother. 46, 3978–3980.

Бидл, Б. М., Трехан, И., Фосиа, П. Дж. И Шойчет, Б. К. (2002).

Структура, 10, 413–424.

Бесейро, А., Домингес, Л., Рибера, А., Вила, Дж., Молина, Ф.,

Вильянуэва, Р., Эйрос, Дж. М. и Боу, Г. (2004). Противомикробный. Агенты

Chemother. 48, 1374–1378.

Bergogne-Be

´re

´zin, E. & Towner, K. J. (1996). Clin. Microbiol. Ред. 9,

148–165.

Бхаттачарья М., Тот, М., Антунес, Н. Т., Смит, К. А. и

Вакуленко, С. Б. (2014). Acta Cryst. D70, 760–771.

Bou, G. & Martı

´nez-Beltra

´n, J.(2000). Противомикробный. Агенты

Chemother. 44, 428–432.

Брэдфорд, П. А., Урбан, К., Мариано, Н., Проян, С. Дж., Рахал, Дж. Дж. И

Буш, К. (1997). Противомикробный. Агенты Chemother. 41, 563–569.

Институт клинических и лабораторных стандартов (2014). M100-S24:

Стандарты производительности

для испытаний на чувствительность к противомикробным препаратам;

Двадцать четвертое информационное приложение. Уэйн: Институт клинических и лабораторных стандартов

.

Коэльо, Дж., Вудфорд, Н., Тертон, Дж. И Ливермор, Д. М. (2004). J.

Hosp. Заразить. 58, 167–169.

Кричлоу, Г. В., Кузин, А. П., Нукага, М., Маяма, К., Савай, Т. и

Нокс, Дж. Р. (1999). Биохимия, 38, 10256–10261.

ДеЛано, В. Л. (2002). PyMOL. http://www.pymol.org.

Делчер А. Л., Братке К. А., Пауэрс Э. К. и Зальцберг С. Л. (2007).

Биоинформатика, 23, 673–679.

Де Мистер, Ф., Йорис, Б., Рекингер, Г., Бельфроид-Бургиньон, К.,

Fre

` re, J.-M. И Уэйли, С. Г. (1987). Biochem. Pharmacol. 36, 2393–

2403.

Disz, T., Akhter, S., Cuevas, D., Olson, R., Overbeek, R., Vonstein, V.,

Stevens, R. & Edwards, RA (2010). BMC Bioinformatics, 11, 319.

Docquier, J.-D., Pantanella, F., Giuliani, F., Thaller, MC,

Amicosante, G., Galleni, M., Fre

` re, J .-М., Буш К. и Россолини,

GM (2002). Противомикробный. Агенты Chemother.46, 1823–1830.

Эмсли, П., Локамп, Б., Скотт, В. Г. и Коутан, К. (2010). Acta

Кристалл. D66, 486–501.

Галлени, М., Франческини, Н., Квинтинг, Б., Фатторини, Л., Орефики, Г.,

Ораторе, А., Фре

` re, J.-M. И Amicosante, G. (1994). Противомикробный.

Агенты Chemother. 38, 1608–1614.

Galleni, M. & Fre

` re, J.-M. (1988). Biochem. J. 255, 119–122.

He

´ritier, C., Poirel, L.И Нордманн П. (2006). Clin. Microbiol. Заразить.

12, 123–130.

Hujer, KM, Hamza, NS, Hujer, AM, Perez, F., Helfand, MS,

Bethel, CR, Thomson, JM, Anderson, VE, Barlow, M., Rice,

LB, Tenover, ФК и Бономо, РА (2005). Противомикробный. Агенты

Chemother. 49, 2941–2948.

Ким, Дж., Юнг, Х.И., Ан, Й.Дж., Ли, Дж. Х., Ким, SJ, Чжон, Ш., Ли,

КДж, Сух, П.-Г., Ли, Х.-С., Ли, С.Х. и Ча, С.-С. (2006). Мол.

Microbiol. 60, 907–916.

Кузьмич П. (1996). Анальный. Biochem. 237, 260–273.

Ласковски Р. А., МакАртур М. В., Мосс Д. С. и Торнтон Дж. М.

(1993). J. Appl. Cryst. 26, 283–291.

Ли, Дж. Х., Бэ, И. К. и Ли, С. Х. (2012). Med. Res. Ред. 32, 216–232.

Ли, Дж. Х., Чон, С. Х., Ча, С.-С. И Ли, С. Х. (2009). PLoS Pathog. 5,

e1000221.

Ли, Дж. Х. и Ли, С.Х. (2006). Res. J. Microbiol. 1, 1–22.

Ли, К., Йонг, Д., Чой, Ю.С., Юм, Дж. Х., Ким, Дж. М., Вудфорд, Н.,

, Ливермор, Д. М. и Чонг, Ю. (2007). Int. J. Antimicrob. Агенты,

29, 201–206.

Лю С.-Л., Хессель А. и Сандерсон К. Э. (1993). Proc. Natl Acad. Sci.

США, 90, 6874–6878.

Маммери, Х., Гийон, Х., Эб, Ф. и Нордманн, П. (2010). Противомикробный.

Агенты Chemother. 54, 4556–4560.

Муршудов, Г.Н., Скуба

´k, П., Лебедев, А. А., Панну, Н. С., Штайнер,

Р. А., Николлс, Р. А., Винн, М. Д., Лонг, Ф. и Вагин, А. А. (2011).

Acta Cryst. D67, 355–367.

Нукага, М., Харута, С., Танимото, К., Когуре, К., Танигучи, К.,

Тамаки, М. и Савай, Т. (1995). J. Biol. Chem. 270, 5729–5735.

Отвиновски, З. и Минор, В. (1997). Методы Энзимол. 276, 307–

326.

научные статьи

Acta Cryst.(2014). D70, 2924–2936 Jeon et al. ADC-68 2935

электронная перепечатка

% PDF-1.7 % 1 0 объект > эндобдж 2 0 obj > эндобдж 3 0 obj > эндобдж 4 0 obj > эндобдж 5 0 obj > / Border [0 0 0] / F 4 / Rect [271.117 798.113 397.573 803.137] / Subtype / Link / Type / Annot >> эндобдж 6 0 obj > / Border [0 0 0] / F 4 / Rect [359.39 771.114 410.606 777.012] / Subtype / Link / Type / Annot >> эндобдж 7 0 объект > / Граница [0 0 0] / F 4 / Прямоугольник [315.942 715.423 448.573 721.321] / Подтип / Ссылка / Тип / Аннотация >> эндобдж 8 0 объект > / Border [0 0 0] / F 4 / Rect [536.466 650.193 595.466 675.193] / Subtype / Link / Type / Annot >> эндобдж 9 0 объект > эндобдж 10 0 obj > эндобдж 11 0 объект > эндобдж 12 0 объект > эндобдж 13 0 объект > эндобдж 14 0 объект > эндобдж 15 0 объект > эндобдж 16 0 объект > эндобдж 17 0 объект > эндобдж 18 0 объект > эндобдж 19 0 объект > эндобдж 20 0 объект > эндобдж 21 0 объект > эндобдж 22 0 объект > эндобдж 23 0 объект > эндобдж 24 0 объект > эндобдж 25 0 объект > эндобдж 26 0 объект > / Border [0 0 0] / F 4 / Rect [132.868 132,907 220,985 137,932] / Подтип / Ссылка / Тип / Аннотация >> эндобдж 27 0 объект > эндобдж 28 0 объект > эндобдж 29 0 объект > эндобдж 30 0 объект > эндобдж 31 0 объект > эндобдж 32 0 объект > эндобдж 33 0 объект > эндобдж 34 0 объект > эндобдж 35 0 объект > эндобдж 36 0 объект > эндобдж 37 0 объект > эндобдж 38 0 объект > эндобдж 39 0 объект > эндобдж 40 0 объект > эндобдж 41 0 объект > эндобдж 42 0 объект > эндобдж 43 0 объект > эндобдж 44 0 объект > эндобдж 45 0 объект > эндобдж 46 0 объект > эндобдж 47 0 объект > эндобдж 48 0 объект > эндобдж 49 0 объект > эндобдж 50 0 объект > эндобдж 51 0 объект > эндобдж 52 0 объект > эндобдж 53 0 объект > эндобдж 54 0 объект > эндобдж 55 0 объект > эндобдж 56 0 объект > эндобдж 57 0 объект > эндобдж 58 0 объект > эндобдж 59 0 объект > эндобдж 60 0 объект > эндобдж 61 0 объект > эндобдж 62 0 объект > эндобдж 63 0 объект > эндобдж 64 0 объект > эндобдж 65 0 объект > эндобдж 66 0 объект > эндобдж 67 0 объект > / Border [0 0 0] / F 4 / Rect [73.; @) 53 敏) ˄> c1'o6 $.\ ǏQBl ~ Jirq / l @) όP8O ׃ m; F3B%? yJiCXNǾ {-wH # 𺁔 P | Y͗Ow 1Ex / oL1iTq5 X01 / e = -oUw #: $ he = Rm YhQ] GEV7? = {0H ն 9 Sh [逫 M} yk ~ | S` {xC ~ UPg 紌 P> BOmO̤ Y & L҇õjw.ɪo9: ~ {vqh3; ʖ 椄 N ⢁: k3 Zpft * I] gJl = S% FqdX $ RqIBwK (~ R4v + aI 'u̒X9Q + G

T-h-2 иммунитет и CD3 + CD45RBlow-активированные Т-клетки у мышей, иммунизированных рекомбинантной палочкой Calmette-Gueérin, экспрессирующей эпитоп основной нейтрализующей детерминанты ВИЧ-1 | Возбудители и болезни

"> Абстрактные

Генная инженерия Mycobacterium bovis –bacillus Calmette – Guérin для экспрессии чужеродных эпитопов является привлекательной стратегией в области эпитопных вакцин.Мы сконструировали «вектор-ловушку для эпитопа» с шаперонином-10 Mycobacterium tuberculosis в качестве антигена-носителя и использовали его для экспрессии эпитопа главной нейтрализующей детерминанты ВИЧ-1. Мы также идентифицировали новый промотор шаперонина-10, который был гиперэкспрессивным по сравнению с промотором белка теплового шока-65. Спленоциты мышей, иммунизированных рекомбинантной палочкой Кальметта-Герена, показали усиленную пролиферацию лимфоцитов и секрецию интерлейкина-4 (но не интерферона-γ). Группа, иммунизированная рекомбинантными бациллами Кальметта-Герена, также демонстрировала умеренную реакцию гиперчувствительности замедленного типа и высокую частоту CD3 + CD45RB low -активированных Т-клеток вместе с высоким титром антиглавных нейтрализующих детерминантных детерминантных антител иммуноглобулина G.Таким образом, эта система доставки эпитопа индуцировала сильную эпитоп-специфичную поляризацию T-h-2.

" data-legacy-id="ss0"> Введение

Bacillus Calmette – Guérin (BCG) - это аттенуированный штамм Mycobacterium bovis , впервые введенный людям в качестве вакцины для предотвращения туберкулеза в 1921 году. На сегодняшний день более трех миллиардов человек во всем мире вакцинированы БЦЖ с незначительными осложнениями (Aronson и др. , 2004). Иммунитет, вызванный БЦЖ, сохраняется даже после однократного приема.В зависимости от пути введения БЦЖ индуцирует как системный иммунитет, так и иммунитет слизистых оболочек (Chen et al. , 2004). БЦЖ также является идеальным кандидатом для иммунотерапевтических средств в дополнение к своим иммунопрофилактическим способностям (Cheng et al. , 2004). В результате этих качеств основные усилия были направлены на превращение БЦЖ в мультивакцинный носитель. БЦЖ обладает уникальными преимуществами в качестве носителя для поливалентной вакцины. Он термостабилен, прост в выращивании, не подвержен влиянию материнских антител и экономичен.Ее можно вводить в виде пероральной вакцины в любое время после рождения. На сегодняшний день опубликовано множество рекомбинантных вакцин БЦЖ (р-БЦЖ), экспрессирующих вирусные, бактериальные, простейшие и глистные антигены (Dennehy & Williamson, 2005). Таким образом, БЦЖ служит идеальным кандидатом для экспрессии чужеродных эпитопов и ценным инструментом в вакцинологии.

Основной проблемой при разработке вакцины является индукция соответствующего иммунного ответа против антигенов, содержащих криптические (переходные) эпитопы.Например, петля V3 гликопротеина оболочки gp120 ВИЧ скрыта глубоко внутри молекулы и обнажается только после лигирования CD4 (Rizzuto et al. , 1998). Чтобы обойти это ограничение, Мацуо (1990) сконструировал первый вектор-ловушку эпитопа для рекомбинантной БЦЖ, используя α-антиген Mycobacterium kansasii (Ag85B) в качестве носителя. Основной принцип «вектора-ловушки для эпитопа» заключается в трансплантации эпитопа из недружелюбной для иммунной системы среды в среду, благоприятную для иммунитета.После отчета Мацуо (1990) были сконструированы еще два вектора-ловушки эпитопа с использованием супероксиддисмутазы Mycobacterium tuberculosis, (Hetzel et al., , 1998) и Mycobacterium leprae 18 кДа белка теплового шока (Hsp) (da Cruz и др. , 2001) в качестве носителей. Помимо экспрессии криптических эпитопов, эти векторы также можно использовать для экспрессии эпитопов антигенов, которые являются цитотоксическими или нестабильными в BCG.

В этом исследовании мы сконструировали «вектор-ловушку для эпитопа» на основе r-BCG с M.tuberculosis шаперонин-10 (Cpn10) в качестве антигена-носителя. Мы выбрали Cpn10, поскольку он является одним из хорошо охарактеризованных иммунодоминантных антигенов микобактерий (Minden et al. , 1984; Barnes et al. , 1992; Mehra et al. , 1992). Это hsp, кристаллическая структура которого известна (Taneja & Mande, 2002). В отличие от широко распространенного мнения, что бактериальный Hsps индуцирует аутоиммунитет, этот белок обеспечивает значительную защиту от адъювантного артрита (Agnello et al., 2002) и аутоиммунный энцефаломиелит на мышиной модели (Ben-Nun et al. , 1995). С этим вектором эпитоп главной нейтрализующей детерминанты (PND) ВИЧ-1 успешно экспрессировался в r-BCG. И клеточные, и гуморальные иммунные ответы, индуцированные этим штаммом r-BCG, оценивали на мышах Balb / c.

" data-legacy-id="ss1"> Материалы и методы

" data-legacy-id="ss2"> Источник реагентов

Mycobacterium tuberculosis Cpn10 был получен из Университета штата Колорадо в рамках программы передачи материалов исследований ТБ NIH NIAID (контракт №1 AI-75320).ВИЧ-1 gp120 и моноклональные антитела 4G10, 5F7 и 447-52D были получены из программы AIDS Reagents. Все ферменты были получены от New England Biolabs (Ипсвич, Массачусетс). Пептид PND был получен от Invitrogen (Carlsbad, CA).

" data-legacy-id="ss3"> Конструирование "вектора-ловушки эпитопа" на основе r-BCG

Escherichia coli DH5α использовали для всех манипуляций с ДНК. Вектор-ловушка для эпитопа был сконструирован с помощью «кассетного мутагенеза» (Wells et al. , 1985).Трехмерную структуру антигена M. tuberculosis Cpn10 анализировали с использованием программного обеспечения insight ii [Biosym / MSI Release 95.0 (1995), Сан-Диего, Калифорния]. Участок петли антигена Cpn10 был удален и заменен «рестрикционной кассетой» Bsm BI –Asc I –Bsm BI; он был назван pCMC. Синтетические олигонуклеотиды, кодирующие эпитоп PND, вставляли в мутантную кассету для создания химер Cpn10-PND. Использовали два типа синтетических олигонуклеотидов (таблица 1), один кодировал только эпитоп PND, а другой кодировал последовательность петли, а также эпитоп PND.Таким образом, были сконструированы две разные химеры, а именно химера замены, в которой эпитоп PND заменял петлю Cpn10 (плазмида pCRC), и химера вставки, в которой эпитоп PND был вставлен в петлю Cpn10 (плазмида pCIC).

Таблица 1 Праймеры и синтетические олигонуклеотиды

, используемые для конструирования рекомбинантной бациллы Кальметта – Герена (r-BCG)

TGAC2 9068GAC 9068GAC ' RIQRGPGRAFV
Праймер Последовательность
va1
Va1 VA2 5'-GCGCGGTTTCGTCGTATTCG-3 '
VA3 5'-GAACACGCTCTACTACTTGG-3'
VA5 5'-GCTCCAATCGTGGCGAAGGT-5 '
va3BB 5'-GGCGCGCCCGTCTCCTCGTTGGCCTGCACGAGAA -5 '
va4BB 3'-GGCGCGCCCGTCTCCCTGACACCGCCAAGGAGAA-5'
Resynolig 5'-ACGAGCGCATCCAGAGGGGTCCTGGTCGCGCGTTCGTGACCATTGGTAAGC-3 '
3'-CGCGTAGGTCTCCCCAGGGACCAGCGCGCAAGCACTGGTAACCATTCGGACT-5'
RIQRGPGRAFVTIGK
Insynol Igo 5'-ACGAGGCCGAGACCACGACCGCGCGCATCCAGAGGGGTCCTGGTCGCGCGTTCGT
3'-CCGGCTCTGGTGCTGGCGCGCGTAGGTCTCCCCAGGACCAGCGCGCAAGCA
GACCATTGGTAAGTCCGGTCTGGTCATTC-3 '
CTGGTAACCATTCAGGGGAGACCAGTAAGGACT-5'
TIGK
va1 9068-TCACCTG-3' 9068G2 9068GTC9 9068GTC9 9068GTC9 9068GC9 9068GTC9 9068GTC9 9068GT 9 5'-GAACACGCTCTACTACTTGG-3 ' RIQRGPGRAFVTIGK RIQRGPGRAFV TIGK
Праймер Последовательность
va1 5'-TGACCCGGACATTGCACCTG-3 '
va5 5'-GCTCCAATCGTGGCGAAGGT-5'
va3BB 5'-GGCGC7TGCCCGTC9 5'-GGCGCGCCBCC69

5'-GGCGC7GCCBCC69 5'-GGCGC7GCCBCC69 3'-GGCGCGCCCGTCTCCCTGACACCGCCAAGGAGAA-5 '
Resynolig 5'-ACGAGCGCATCCAGAGGGGTCCTGGTCGCGCGTTCGTGACCATTGGTAAGC-3'
3'-CGCGTAGGTCTCCCCAGGGACCAGCGCGCAAGCACTGGTAACCATTCGGACT-5 '
Insynoligo 5 '-ACGAGGCCGAGACCACGACCGCGCGCATCCAGAGGGGTCCTGGTCGCGCGTTCGT
3'-CCGGCTCTGGTGCTGGCGCGCGTAGGTCTCCCCAGGACCAGCGCGCAAGCA
GACCATTGGTAAGTCCGGTCTGGTCATTC-3'
CTGGTAACCATTCAGGGGAGACCAGTAAGGACT-5 '
Таблица 1

Праймеры и синтетические олигонуклеотиды, используемые для конструирования рекомбинантной бациллы Кальметта – Герена ( r-BCG)

RIQRGPGRAFVTIGK RIQRGPGRAFV TIGK
Праймер Последовательность
va1 5'-TGACCCGGACATTGCACCTG-3 '
va2GTC9 9068-GTC9 9068GTC9 9068-GTC9 9068-GTC9 9068-GTC9 9068-GTC9 9068-GTC9 9068-GTC9 9068-GTC9 9068-GTC9 9068-GTC9 9068-GTC9 9068-GTC9 9068-GTC9 9068-GTC9 9068-GTC9 9068-GTC9 9068-G69 5'-GAACACGCTCTACTACTTGG-3 '
VA5 5'-GCTCCAATCGTGGCGAAGGT-5'
va3BB 5'-GGCGCGCCCGTCTCCTCGTTGGCCTGCACGAGAA-5 '
va4BB 3'-GGCGCGCCCGTCTCCCTGACACCGCCAAGGAGAA-5'
Resynolig 5'-ACGAGCGCATCCAGAGGGGTCCTGGTCGCGCGTTCGTGACCATTGGTAAGC-3 '
3'-CGCGTAGGTCTCCCCAGGGACCAGCGCGCAAGCACTGGTAACCATTCGGACT-5'
Insynoligo 5'-ACGAGGCCGAGACCACGACCGCGCGCATCCAGAGGGGTCCTGGTCGCGCGTTCGT
3'-CCGGCTCTGGTGCTGGCGCGCGTAGGTCTCCCCAGGACCAGCGCGCAAGCA
GACCATTGGTAAGTCCGGTCTGGTCATTC-3 '
CTGGTAACCATTCAGGGGAGACCAGTAAGGACT-5'
5'689 9068TGACGTATTCG-3 ' 9068GACGACGTATTCG-3' RIQRGPGRAFVTIGK а) были субклонированы в челночных векторов E. coli– микобактерий pMV206, pMV306, pMV261 и pMV361. pMV206 и pMV306 являются векторами клонирования, тогда как pMV261 и pMV361 являются векторами экспрессии с микобактериальным промотором hsp65 (Aldovini & Young, 1991; Stover et al. , 1991). pMV206 и его производное pMV261 являются эписомными векторами, тогда как pMV306 и его производное pMV361 являются интегративными векторами. Таким образом, были сконструированы восемь различных рекомбинантных плазмид (p206CRC, p206CIC, p306CRC, p306CIC, p261CRC, p261CIC, p361CRC и p361CIC).Эти плазмиды электропорировали в микобактерии, как описано ранее (Wards & Collins, 1996). Плазмиды, использованные в этом исследовании, перечислены в таблице 2.

Рисунок 1

Конструирование и экспрессия шаперонин-основной нейтрализующей детерминанты (Cpn-PND) химеры в рекомбинантной палочке Кальметта-Герена (r-BCG). (а) Показаны два типа химеры Cpn10-PND с их гомологичным промотором (жирная стрелка) и терминатором (жирная петля). Замещающая химера имеет область петли, замененную эпитопом PND, тогда как химера вставки имеет эпитоп PND, вставленный в петлю.(b) Последовательность предполагаемого промотора Cpn10 (282 п.н.), идентифицированная в этом исследовании. Предполагаемые -10, -35 и сайт начала транскрипции (TSS) были предсказаны с помощью анализа in silico (http://www.fruitfly.org/seq_tools/promoter.html). CIRCE (стрелки), Rbs и стартовый кодон трансляции (TSC) также показаны жирным шрифтом. (c) Распознавание химерного антигена мышиными моноклональными антителами, специфичными к эпитопу PND ВИЧ-1. Бесклеточный лизат r-BCG, несущий p306CRC, анализировали вестерн-блоттингом с моноклональными антителами, специфичными к эпитопу PND.Дорожка: 1, 4G10; 2, 5F2; 3, 447-52D; M, маркер с высокой молекулярной массой (BioRad).

Рисунок 1

Конструирование и экспрессия шаперонин-основной нейтрализующей детерминанты (Cpn-PND) химеры в рекомбинантной палочке Кальметта-Герена (r-BCG). (а) Показаны два типа химеры Cpn10-PND с их гомологичным промотором (жирная стрелка) и терминатором (жирная петля). Замещающая химера имеет область петли, замененную эпитопом PND, тогда как химера вставки имеет эпитоп PND, вставленный в петлю.(b) Последовательность предполагаемого промотора Cpn10 (282 п.н.), идентифицированная в этом исследовании. Предполагаемые -10, -35 и сайт начала транскрипции (TSS) были предсказаны с помощью анализа in silico (http://www.fruitfly.org/seq_tools/promoter.html). CIRCE (стрелки), Rbs и стартовый кодон трансляции (TSC) также показаны жирным шрифтом. (c) Распознавание химерного антигена мышиными моноклональными антителами, специфичными к эпитопу PND ВИЧ-1. Бесклеточный лизат r-BCG, несущий p306CRC, анализировали вестерн-блоттингом с моноклональными антителами, специфичными к эпитопу PND.Дорожка: 1, 4G10; 2, 5F2; 3, 447-52D; M, маркер с высокой молекулярной массой (BioRad).

Таблица 2 Плазмиды

, используемые для конструирования рекомбинантной бациллы Кальметта – Герена (r-BCG)

Праймер Последовательность
va1 5'-TGACCCGGACATTGCACCTG-3 '
va2 5'-GCGCGGTTTCGTCGTATTCG-3'
5'-GCTCCAATCGTGGCGAAGGT-5 '
va3BB 5'-GGCGCGCCCGTCTCCTCGTTGGCCTGCACGAGAA-5'
va4BB 3'-GGCGCGCCCGTCTCCCTGACACCGCCAAGGAGAA-5 '
Resynolig 5'-ACGAGCGCATCCAGAG GGGTCCTGGTCGCGCGTTCGTGACCATTGGTAAGC-3 '
3'-CGCGTAGGTCTCCCCAGGGACCAGCGCGCAAGCACTGGTAACCATTCGGACT-5'
Insynoligo 5'-ACGAGGCCGAGACCACGACCGCGCGCATCCAGAGGGGTCCTGGTCGCGCGTTCGT
3'-CCGGCTCTGGTGCTGGCGCGCGTAGGTCTCCCCAGGACCAGCGCGCAAGCA
RIQRGPGRAFV
GACCATTGGTAAGTCCGGTCTGGTCATTC-3 ′
CTGGTAACCATTCAGGGGGAGACCAGTAAGGACT 9069
продукты вектора Invitrogen) pCR2.1 Cpn10 вставка химеры в pCR2.1 9069CR) химера в pMV261 Escco11 9068 RICco челночный вектор (интегрируемый с промотором hsp65) p361CIC6 9068 RI
Плазмида Описание Сайт клонирования
PCR2.1 -
pCpn10 700 п.н. Ген Cpn10 в pCR2.1 -
pCMC Cpn10 кассета мутанта в pCR2.1 -
pCRC Cpn10 замена химеры
-
pCRCO Cpn10 ORF для замены химеры в pCR2.1 -
pCICO 1 -
pMV206 Escherichia coli – микобактерии челночный вектор (эписомальный) -
p206CRC 9068 Cpnimera6 906 906 906 p911 замена Cpn10 вставка химеры в pMV206 Eco RI
pMV261 Escherichia coli –замещающий вектор микобактерий челночного вектора (эписомальный с промотором hsp65 Eco RI
p261CIC Cpn10 вставка химеры в pMV261 Eco RI
coli
p306CRC Cpn10 Замещающая химера в pMV306 Eco RI
p306CIC Cpn10 вставка химеры в pMV688 -
p361CRC Cpn10 замещающая химера в pMV361 Eco RI
p361CIC6
9068 9068 9068 pCR290 9068 9068 9068 pCR2.1 9068 9068 9068 9068 p69 M Eco RI
Плазмида Описание Сайт клонирования
pCR2.1 Линейный вектор для клонирования продуктов ПЦР (Invitrogen) -
pCpn10 700 п.н. Cpn10 ген в pCR2.1 -
pCMC10 11 мутантный 1 -
pCRC Cpn10 Замена химеры в pCR2.1 -
pCIC Cpn10 вставка химеры в pCR2.1 -
pCRCO Cpn10 ORF для замены химеры в pCR2.1 -
pCICO Cpn10 9068 pCICO Escherichia coli –микобактерия челночный вектор (эписомальный) -
p206CRC Cpn10 замещающая химера в pMV206 вставка Eco RI 9068pV9 9068 pMV206 Eco RI
pMV261 Escherichia coli –микобактерийный челночный вектор (эписомальный с промотором hsp65) -
p261CRC
chimera1
p261CIC C pn10 вставка химеры в pMV261 Eco RI
pMV306 Escherichia coli –микобактерий челночный вектор (интегративный) - - pV9
p306CIC Cpn10 вставка химеры в pMV306 Eco RI
pMV361 Promoter , вектор h688 p361CRC Cpn10 замена химеры в pMV361 Eco RI
p361CIC Cpn10 вставка химеры в конструкцию pMV367 9069 9069 9069 Eco Eco 9069 рекомбинантная палочка us Кальмет-Герен (r-BCG)

9068 9068 9068 pCR290 9068 9068 9068 pCR2.1 9068 9068 9068 9068 p69 M pV6 Eco RI - шаттл-шаттл9 9 9068 9068 9068 pCR290 9068 9068 9068 pCR2.1 9068 9068 9068 9068 p69 M Eco RI - шаттл-шаттл9 9
Плазмида Описание Сайт клонирования
pCR2.1 Линейный вектор для клонирования продуктов ПЦР (Invitrogen) -
pCpn10 700 п.н. Cpn10 ген в pCR2.1 -
pCMC10 11 мутантный 1 -
pCRC Cpn10 Замена химеры в pCR2.1 -
pCIC Cpn10 вставка химеры в pCR2.1 -
pCRCO Cpn10 ORF для замены химеры в pCR2.1 -
pCICO Cpn10 9068 pCICO Escherichia coli –микобактерия челночный вектор (эписомальный) -
p206CRC Cpn10 замещающая химера в pMV206 вставка Eco RI 9068pV9 9068 pMV206 Eco RI
pMV261 Escherichia coli –микобактерийный челночный вектор (эписомальный с промотором hsp65) -
p261CRC
chimera1
p261CIC C pn10 вставка химеры в pMV261 Eco RI
pMV306 Escherichia coli – микобактерии челночный вектор (интегративный) - -
p306CIC Cpn10 вставка химеры в pMV306 Eco RI
pMV361 Promoter p361CRC Cpn10 замена химеры в pMV361 Eco RI
p361CIC Cpn10 вставка химеры в pMV68869 9068 9068 RI 9068 9068 9068 9068 9068 9069 9068 9068 9068 9069 9068 9068 9068 Сайт клонирования
pCR2.1 Линейный вектор для клонирования продуктов ПЦР (Invitrogen) -
pCpn10 700 п.н. Cpn10 ген в pCR2.1 -
pCMC10 11 мутантный 1 -
pCRC Cpn10 Замена химеры в pCR2.1 -
pCIC Cpn10 вставка химеры в pCR2.1 -
pCRCO Cpn10 ORF для замены химеры в pCR2.1 -
pCICO Cpn10 9068 pCICO Escherichia coli –микобактерия челночный вектор (эписомальный) -
p206CRC Cpn10 замещающая химера в pMV206 вставка Eco RI 9068pV9 9068 pMV206 Eco RI
pMV261 Escherichia coli –микобактерийный челночный вектор (эписомальный с промотором hsp65) -
p261CRC
chimera1
p261CIC C pn10 вставка химеры в pMV261 Eco RI
pMV306 Escherichia coli –микобактерий челночный вектор (интегративный) - - pV9
p306CIC Cpn10 вставка химеры в pMV306 Eco RI
pMV361 Promoter p361CRC Cpn10 замена химеры в pMV361 Eco RI
p361CIC Cpn10 вставка химеры в pMV689 Expression 9069 9019 9069 Ecopus 7 9019 9019 9069 9069 10 Escherichia coli и микобактерии

Бесклеточные лизаты из E.coli , Mycobacterium smegmatis и БЦЖ получали обработкой ультразвуком. Вкратце, клетки промывали фосфатно-солевым буфером (PBS) и ресуспендировали в буфере TEN [50 мМ Трис (pH 7,5), 5 мМ EDTA и 150 мМ NaCl], содержащем ингибиторы протеаз (2 мМ фенилметилсульфонилфторид, 1,7 единица ингибитора трипсина ( TIU) мл -1 апротинина, 10 мкМ лейпептина и 10 мкМ пепстатина) и обработали ультразвуком (Soniprep-150 ISTCP, Palisades Park, NJ) (шесть циклов по 30 секунд пульса и 30 секунд отдыха).Обработанный ультразвуком центрифугировали при 9300 g и концентрацию белка в супернатанте оценивали методом Брэдфорда, следуя инструкциям производителя (Bio-Rad, Hercules, CA). Образцы разделяли электрофорезом в полиакриламидном геле (PAGE) трицин-додецилсульфат натрия (SDS) и переносили на мембрану из нитроцеллюлозной бумаги (NCP) с использованием устройства для переноса (Bio-Rad). После блокирования 5% обезжиренным сухим обезжиренным молоком, не содержащим липидов, были добавлены моноклональные антитела 4G10, 5F7 и 447-52D (разведение 1: 200).После отмывки добавляли конъюгат антимышиного иммуноглобулина G с пероксидазой хрена (IgG-HRP) (разведение 1: 1000). Наконец, блот проявили с использованием диаминобензидина (DAB), H 2 O 2 и хлорида кобальта (CoCl 2 ).

Планшеты для иммуноферментного анализа (ELISA) покрывали бесклеточным лизатом рекомбинантного M . smegmatis (5 мкг мл -1 в бикарбонатном буфере, pH 9) и инкубировали при 4 ° C. Моноклональное антитело 4G10 (разведение 1: 200) и конъюгат антимышиного IgG-HRP (разведение 1: 1000) добавляли после блокирования лунок 5% бычьим сывороточным альбумином (BSA).Наконец, были добавлены субстраты ортофенилендиамин (OPD) и H 2 O 2 . Через 10 мин реакцию останавливали 4 M H 2 SO 4 и измеряли оптическую плотность при 490 нм (OD 490 ) с использованием ридера для ELISA (Spectra Max 250, Саннивейл, Калифорния).

Новый промотор Cpn10, идентифицированный в этом исследовании, был проанализирован с использованием программного обеспечения для прогнозирования промотора на основе нейронной сети (http://www.fruitfly.org/seq_tools/promoter.html), разработанного Ризом (2001).

" data-legacy-id="ss5"> Протокол иммунизации

БЦЖ дикого типа и р-БЦЖ выращивали в бульоне Миддлбрук 7H9 с добавкой альбумин-декстроза-каталаза (ADC) и 0,05% Твина-80; 6-8-недельные культуры собирали, промывали в PBS, диспергировали с помощью мягкой обработки ультразвуком и использовали для иммунизации. Бактериальные КОЕ определяли путем посева 10-кратных серийных разведений на чашки Миддлбрука 7h20 с ADC. Канамицин использовали в концентрации 25 мкг / мл -1 для отбора рекомбинантов.Свободные от патогенов самки мышей Balb / c (6-8 недель) были получены из Университета ветеринарии и зоотехники Тамил Наду, Ченнаи, Индия. Для экспериментов по иммунизации использовали три группы мышей по восемь животных в группе (наивные, иммунизированные BCG и r-BCG-иммунизированные животные); 1 × 10 6 КОЕ БЦЖ / р-БЦЖ вводили подкожным путем. Следуя стратегии гомотипической первичной-бустерной вакцинации, животные получали повторную вакцинацию либо БЦЖ, либо р-БЦЖ через 15 дней после примирования. Через пятнадцать дней после ревакцинации животных умерщвляли в соответствии с руководящими принципами, предоставленными Комитетом по контролю и надзору за экспериментами на животных (CPCSEA), Индия.

" data-legacy-id="ss6"> Анализ пролиферации спленоцитов

спленоцитов отделяли с помощью сетчатого фильтра, а мононуклеарные клетки очищали центрифугированием Ficoll-Hypaque; 0,1 × 10 6 клеток высевали в 96-луночный планшет в среде RPMI, содержащей 10% эмбриональной телячьей сыворотки (Gibco BRL, Карлсбад, Калифорния), 50 мкМ β-меркаптоэтанол, 2 мМ l-глутамин и 1 × антибиотик и антимикотик. раствор (Gibco BRL). Клетки стимулировали митогеном (фитогемагглютинин, PHA; 1 мкг / мл -1 ) или антигенами (пептид PND или антиген gp120; 10 мкг / мл -1 ) и собирали на 3-й день (для митогена) или 5-й день. (для антигена).Пролиферацию измеряли по включению [ 3 H] -тимидина (1 мкКи на лунку; BARC, Мумбаи, Индия). Индекс стимуляции рассчитывали как отношение числа импульсов в минуту (имп / мин) в стимулированных лунках к числу импульсов в минуту в контрольных лунках.

" data-legacy-id="ss7"> Оценка цитокинов

Спленоцитов от наивных и вакцинированных животных стимулировали пептидом PND или антигеном Cpn10 (10 мкг / мл -1 ) в течение 72 часов. Уровни интерлейкина-4 (IL-4) и интерферона-γ (IFN-γ) в супернатанте культуры оценивали с использованием набора цитокинов BD OptEIA ™ (BD Biosciences, Сан-Диего, Калифорния) в соответствии с инструкциями производителя.Самый низкий уровень обнаружения составил 7,8 пг / мл -1 для IL-4 и 31,3 пг / мл -1 для IFN-γ.

" data-legacy-id="ss8"> Количественное определение CD3 + CD45RB low -активированных Т-клеток методом проточной цитометрии

Спленоциты фиксировали 4% параформальдегидом при 37 ° C в течение 15 минут и хранили при -80 ° C в PBS, содержащем 10% диметилсульфоксид (ДМСО), до дальнейшего анализа. Клетки окрашивали антителами к CD3 (клон 17A2) изотиоцианата флуоресцеина (FITC) и антителами к биотину против CD45RB (клон 16A) (PerCP-стрептавидин) (BD Pharmingen, San Diego, CA).Для анализа клеточного цикла спленоциты стимулировали пептидом PND или антигеном Cpn10 (10 мкг мл -1 ) в течение 72 часов и фиксировали 4% параформальдегидом. Клетки окрашивали биотином против CD45RB (FITC-стрептавидин) и йодидом пропидия (50 мкг мл -1 ). РНК расщепляли РНКазой А. Окрашенные клетки получали после установки ворот лимфоцитов на прямом и боковом разбросе в FACSort и анализировали с использованием программного обеспечения CellQuest (Becton Dickinson, San Diego, CA).

" data-legacy-id="ss9"> Индукция реакции гиперчувствительности замедленного типа (ГЗТ)

Подушечки лап ампутировали через 24 часа после внутрикожной инъекции 10 мкг пептида PND и фиксировали формалином.После этого проводили окрашивание гематоксилином и эозином на 5-микронных срезах подушечек ступни.

" data-legacy-id="ss10"> ELISA антител

Антигенами, используемыми для ELISA, были пептид PND и gp120 (5 мкг мл -1 в бикарбонатном буфере, pH 9). Профилирование изотипов и субизотипов сывороточных антител против PND выполнялось с использованием набора для профилирования изотипов (BD Biosciences) в соответствии с инструкциями производителя. Первичные, вторичные и третичные антитела представляли собой сыворотку мышей, крысиный изотип (субизотип) -специфический антимышиный Ig и конъюгат кроличьего антитела против IgG – HRP (Bangalore Genie, Бангалор, Индия), соответственно.

" data-legacy-id="ss11"> Иммуноблот антител

Ультразвуковой антиген, полученный из r-BCG, разделяли с помощью Tricine-SDS PAGE, переносили на нитроцеллюлозную бумагу и блокировали 5% обезжиренным молочным порошком. После инкубации в течение ночи с сывороткой мышей добавляли конъюгат антимышиных IgG – HRP и инкубировали в течение 1 часа. Полосы визуализировали с использованием DAB, H 2 O 2 и CoCl 2 .

" data-legacy-id="ss12"> Статистический анализ

Для определения уровня значимости использовался тест Манна – Уитни U .Различия считались статистически значимыми, когда значение P было меньше 0,05.

" data-legacy-id="ss13"> Результаты

" data-legacy-id="ss14"> Конструирование «вектора-ловушки эпитопа» и экспрессия химерного антигена Cpn-PND в r-BCG

Трехмерная структура мономера Cpn10 имеет девять β-нитей в двух листах, расположенных в β-бочкообразной складке. Большая мобильная петля (остатки 17–35), которая простирается между β нитями 2 и 3, была выбрана для встраивания эпитопа PND, поскольку он не участвует в процессе олигомеризации (Taneja & Mande, 2002).Две формы химерных антигенов, а именно химера замещения и химера вставки (фиг. 1a), были сконструированы с помощью кассетного мутагенеза и клонированы в четыре различных вектора-челнока Mycobacterium (pMV206, pMV261, pMV306 и pMV361). Ни одна из конструкций не показала экспрессию в Escherichia coli , хотя оба промотора были активны в экспрессии гена lacZ в E. coli (фиг. 1, дополнительные данные). В Mycobacterium smegmatis из восьми конструкций максимальная экспрессия наблюдалась с производными pMV306, а средний уровень экспрессии - с производными pMV261 (рис.2, дополнительные данные). Не было получено колоний с производными pMV206, и не удалось обнаружить экспрессию с производными pMV361. Не было отмечено различий в уровнях экспрессии между вставляемыми и замещающими химерами в любом из скелетов вектора. Результаты ELISA подтвердили результаты вестерн-блоттинга (рис. 3, дополнительные данные).

Рисунок 2

Индукция сильного иммунитета к Т-хелперу-2 (Th-2) рекомбинантной палочкой Кальметта – Герена (r-BCG), экспрессирующей химеру с главной нейтрализующей детерминантой шаперонина (Cpn-PND).(a) Спленоциты стимулировали в условиях in vitro либо митогеном (фитогемагглютинин, PHA; 1 мкг / мл -1 ) или отзывами антигенами (пептид PND и gp120; 10 мкг / мл -1 ), и пролиферацию анализировали с помощью Включение [ 3 H] -тимидина. Спленоциты стимулировали обратными антигенами (пептид PND и Cpn10; 10 мкг / мл -1 ) в течение 72 часов, и цитокины в культуральном супернатанте оценивали с помощью сэндвич-твердофазного иммуноферментного анализа (ELISA).(б) Интерферон-γ (IFN-γ). (c) Интерлейкин-4 (ИЛ-4). Результаты представляют собой средние значения для восьми мышей в каждой группе, а вертикальные полосы обозначают SEM. * P <0,05; ** P <0,01. Эти результаты представляют три независимых эксперимента.

Рисунок 2

Индукция сильного иммунитета к Т-хелперу-2 (Th-2) рекомбинантной палочкой Кальметта – Герена (r-BCG), экспрессирующей химеру с главной нейтрализующей детерминантой шаперонина (Cpn-PND). (a) Спленоциты стимулировали в условиях in vitro либо митогеном (фитогемагглютинин, PHA; 1 мкг / мл -1 ) или отзывами антигенами (пептид PND и gp120; 10 мкг / мл -1 ), и пролиферацию анализировали с помощью Включение [ 3 H] -тимидина.Спленоциты стимулировали обратными антигенами (пептид PND и Cpn10; 10 мкг / мл -1 ) в течение 72 часов, и цитокины в культуральном супернатанте оценивали с помощью сэндвич-твердофазного иммуноферментного анализа (ELISA). (б) Интерферон-γ (IFN-γ). (c) Интерлейкин-4 (ИЛ-4). Результаты представляют собой средние значения для восьми мышей в каждой группе, а вертикальные полосы обозначают SEM. * P <0,05; ** P <0,01. Эти результаты представляют три независимых эксперимента.

Рисунок 3

Генерация CD3 + CD45RB low -активированных Т-клеток у животных, иммунизированных бациллой Кальметта – Герена (БЦЖ) / рекомбинантной палочкой Кальметта – Герена (р-БЦЖ). Точечный график, показывающий процентное содержание клеток CD3 + CD45RB low у наивных (а), иммунизированных БЦЖ (б) и r-БЦЖ (в) животных. (e) Процент активированных Т-клеток и (f) средняя интенсивность флуоресценции активированных Т-клеток. (d) Наложение гистограммы, показывающее подавление маркера CD45RB в CD3 + CD45RB low -активированных Т-клетках от животных, иммунизированных r-BCG.Результаты представляют собой средние значения для восьми мышей в каждой группе, а вертикальные полосы обозначают SEM. * P <0,05. Эти результаты представляют три независимых эксперимента.

Рисунок 3

Генерация CD3 + CD45RB low -активированных Т-клеток у животных, иммунизированных бациллой Кальметта – Герена (БЦЖ) / рекомбинантной палочкой Кальметта – Герена (р-БЦЖ). Точечный график, показывающий процентное содержание клеток CD3 + CD45RB low у наивных (а), иммунизированных БЦЖ (б) и r-БЦЖ (в) животных.(e) Процент активированных Т-клеток и (f) средняя интенсивность флуоресценции активированных Т-клеток. (d) Наложение гистограммы, показывающее подавление маркера CD45RB в CD3 + CD45RB low -активированных Т-клетках от животных, иммунизированных r-BCG. Результаты представляют собой средние значения для восьми мышей в каждой группе, а вертикальные полосы обозначают SEM. * P <0,05. Эти результаты представляют три независимых эксперимента.

Результаты вестерн-блоттинга и ELISA показали, что гомологичный промотор (промотор Cpn10) был гиперэкспрессивным по сравнению с гетерологичным промотором (промотор hsp65).Таким образом, в этом исследовании был идентифицирован новый не охарактеризованный промотор. In silico Анализ последовательности 282 п.н выше фрагмента, включенного в качестве гомологичного промотора в это исследование, показал предполагаемые -10-подобные (в положении -180) и -35-подобные (в положении -203) последовательности вместе с нуклеотидом A ( в положении –172) в качестве сайта старта транскрипции (рис. 1b). Кроме того, были идентифицированы сайт связывания рибосомы (в положении -10) и контролирующий инвертированный повтор экспрессии шаперона (CIRCE), участвующий в регуляции hsps (в положении -174).Положения цис--действующих элементов определяли относительно стартового кодона GTG. На основании профиля экспрессии в M. smegmatis , p306CRC электропорировали в БЦЖ. Экспрессия химерного антигена в r-BCG была подтверждена с использованием 4G10, 5F7 и 447-52D, моноклональных антител, специфичных к эпитопу PND ВИЧ-1 (рис. 1c).

  • 143" data-legacy-id="ss15"> Пролиферация лимфоцитов, индуцированная r-BCG
  • In vitro Пролиферацию спленоцитов от наивных и иммунизированных мышей оценивали после стимуляции клеток митогеном (PHA) или отзывами антигенами (пептид PND и антиген gp120) (рис.2а). Сильный пролиферативный ответ наблюдался при митогенной стимуляции у всех трех групп мышей (наивных, БЦЖ и р-БЦЖ). Что касается обратных антигенов, значительная пролиферация ( P <0,05) наблюдалась против пептида PND только в группе r-BCG. При стимуляции антигеном gp120 только в группе, получавшей наивную терапию, и в группе БЦЖ уровень пролиферации снижался в стимулированных клетках по сравнению с нестимулированными клетками. Такого эффекта не наблюдалось в группе р-БЦЖ.

  • 145" data-legacy-id="ss16"> Индукция сильного иммунного ответа T-helper-2 (Th-2) с помощью r-BCG
  • Мы определили Th-1 vs.Профиль Th-2 в культуральном супернатанте спленоцитов от наивных и иммунизированных животных. Спленоциты из группы БЦЖ секретировали значительное количество ( P <0,05) IFN-γ при стимуляции Cpn10 (фиг. 2b). Напротив, спленоциты из группы r-BCG показали значительно сниженную секрецию IFN-γ при стимуляции пептидом PND и Cpn10 по сравнению с таковой, обнаруженной для нестимулированных клеток. В отношении IL-4 был отмечен обратный феномен, когда клетки из группы r-BCG показали повышенную секрецию ( P <0.05) этого цитокина при стимуляции пептидом PND, а также антигеном Cpn10. Секреции IL-4 не наблюдали, когда спленоциты из наивных групп и групп БЦЖ стимулировали пептидом PND и Cpn10 (фиг. 2c).

  • 147" data-legacy-id="ss17"> Генерация CD3 + CD45RB low -активированных Т-клеток с помощью r-BCG
  • Поскольку значительная пролиферация и секреция цитокинов наблюдались в группах БЦЖ и р-БЦЖ, мы количественно оценили активированные селезенкой Т-клетки. Активированные Т-клетки быстро подавляют поверхностный маркер CD45RB и, таким образом, идентифицируются как популяция CD3 + CD45RB low .Проточный цитометрический анализ показал значительное увеличение ( P <0,05) процента этих клеток у животных, вакцинированных БЦЖ и р-БЦЖ (рис. 3a и d). Кроме того, в этой популяции также наблюдалось значительное подавление CD45RB, о чем свидетельствует снижение средней интенсивности флуоресценции (рис. 3e и f). Чтобы проверить, подверглись ли эти активированные Т-клетки антиген / эпитоп-специфической пролиферации, спленоциты стимулировали PND или Cpn10 и проводили иммунофенотипирование в сочетании с анализом клеточного цикла.Значительное увеличение процента ( P <0,05) пролиферирующих клеток CD45RB low наблюдалось в группах BCG и r-BCG при стимуляции Cpn10, тогда как пептид PND индуцировал пролиферацию только в группе r-BCG (рис. 4).

    Рисунок 4

    Пролиферация CD45RB low -активированных Т-клеток из бациллы Кальметта-Герена (БЦЖ) / рекомбинантной палочки Кальметта-Герена (r-BCG) -иммунизированных животных после стимуляции in vitro с помощью антигенов отзыва.(а) Точечный график, показывающий гейт R2, который включает популяцию клеток CD45RB low . (b) Анализ гистограммы ДНК R2-закрытых клеток. Маркер M1 представляет собой пролиферирующие клетки. (c) Процент пролиферирующих клеток CD45RB low после стимуляции пептидом главной нейтрализующей детерминанты (PND) и антигеном шаперонин-10 (Cpn10). Результаты представляют собой средние значения для восьми мышей в каждой группе, а вертикальные полосы обозначают SEM. * P <0,05. Эти результаты представляют три независимых эксперимента.

    Рис. 4

    Пролиферация CD45RB low- -активированных Т-клеток из бациллы Кальметта-Герена (БЦЖ) / рекомбинантной палочки Кальметта-Герена (r-BCG) -иммунизированных животных после стимуляции in vitro антигенами отзыва. (а) Точечный график, показывающий гейт R2, который включает популяцию клеток CD45RB low . (b) Анализ гистограммы ДНК R2-закрытых клеток. Маркер M1 представляет собой пролиферирующие клетки. (c) Процент пролиферирующих клеток CD45RB low после стимуляции пептидом главной нейтрализующей детерминанты (PND) и антигеном шаперонин-10 (Cpn10).Результаты представляют собой средние значения для восьми мышей в каждой группе, а вертикальные полосы обозначают SEM. * P <0,05. Эти результаты представляют три независимых эксперимента.

  • 150" data-legacy-id="ss18"> Ответ DTH против эпитопа PND
  • Никаких существенных различий в утолщении подушечек стопы между тремя группами не наблюдалось. Гистопатологический анализ подушечек стопы показал минимальную инфильтрацию лейкоцитов и утолщение эндотелия сосудов в подушечке стопы, инъецированной PND, из группы r-BCG, что указывает на легкое воспаление (рис.4, дополнительные данные).

  • 152" data-legacy-id="ss19"> Гуморальный иммунный ответ против эпитопа PND
  • Высокотитровые антитела против PND наблюдались только у мышей, вакцинированных r-BCG, которые также распознавали антиген gp120 (рис. 5a). Профилирование изотипа антител против PND показало преобладание изотипа IgG с незначительными уровнями IgM и IgA (рис. 5а). Профилирование субизотипов показало, что только титр IgG2b был значительно выше в группе r-BCG по сравнению с контролем (рис.5б). Не наблюдалось значительных различий в соотношении анти-PND IgG1 / IgG2a между тремя группами. Наконец, сыворотка из группы r-BCG распознала химерный антиген Cpn-PND вместе с другими иммунодоминантными антигенами, присутствующими в r-BCG, при вестерн-блоттинге (рис. 6).

    Рисунок 5

    Индукция антител с высоким титром антиглавных нейтрализующих детерминант (анти-PND) у мышей, иммунизированных рекомбинантной палочкой Кальметта-Герена (r-BCG), экспрессирующей химерный антиген шаперонин-PND.(a) Профили изотипа и (b) субизотипа сывороток от наивных мышей и мышей, иммунизированных BCG / r-BCG (разведение 1: 300), определяли с помощью иммуноферментного анализа (ELISA). Результаты представляют собой средние значения для восьми мышей в каждой группе, а вертикальные полосы обозначают SEM. * P <0,05; *** P <0,001. Эти результаты представляют три независимых эксперимента.

    Рисунок 5

    Индукция антител с высоким титром антиглавных нейтрализующих детерминант (анти-PND) у мышей, иммунизированных рекомбинантной палочкой Кальметта – Герена (r-BCG), экспрессирующей химерный антиген шаперонин-PND.(a) Профили изотипа и (b) субизотипа сывороток от наивных мышей и мышей, иммунизированных BCG / r-BCG (разведение 1: 300), определяли с помощью иммуноферментного анализа (ELISA). Результаты представляют собой средние значения для восьми мышей в каждой группе, а вертикальные полосы обозначают SEM. * P <0,05; *** P <0,001. Эти результаты представляют три независимых эксперимента.

    Рисунок 6

    Распознавание химерного антигена шаперонин-главной нейтрализующей детерминанты (Cpn-PND) сывороточными антителами мышей, иммунизированных рекомбинантной палочкой Кальметта-Герена (r-BCG).Ультразвуковой антиген, полученный из r-BCG, экспрессирующего эпитоп PND, зондировали с помощью 4G10, моноклонального антитела, специфичного к эпитопу PND (используется в качестве положительного контроля) (дорожка 1), или сыворотки от мышей, иммунизированных r-BCG (дорожки 2–9). ). Объединенные сыворотки от наивных животных использовали в качестве отрицательного контроля (дорожка 10). Жирная стрелка внизу показывает распознавание химерного антигена 4G10 и сыворотками от иммунизированных животных.

    Рисунок 6

    Распознавание химерного антигена шаперонин-главной нейтрализующей детерминанты (Cpn-PND) сывороточными антителами мышей, иммунизированных рекомбинантной палочкой Кальметта-Герена (r-BCG).Ультразвуковой антиген, полученный из r-BCG, экспрессирующего эпитоп PND, зондировали с помощью 4G10, моноклонального антитела, специфичного к эпитопу PND (используется в качестве положительного контроля) (дорожка 1), или сыворотки от мышей, иммунизированных r-BCG (дорожки 2–9). ). Объединенные сыворотки от наивных животных использовали в качестве отрицательного контроля (дорожка 10). Жирная стрелка внизу показывает распознавание химерного антигена 4G10 и сыворотками от иммунизированных животных.

  • 156" data-legacy-id="ss20"> Обсуждение
  • «Векторы-ловушки для эпитопов» преодолевают большинство проблем, связанных с экспрессией цитотоксических антигенов и криптических эпитопов в r-BCG.В этом исследовании мы сконструировали один такой вектор с Cpn10 в качестве носителя с помощью структурно-ориентированного дизайна вектора и экспрессировали эпитоп PND ВИЧ-1 в r-BCG. Отсутствие экспрессии химерных антигенов в Escherichia coli может быть связано с оптимизированным по кодонам синтетическим олигонуклеотидом, кодирующим эпитоп PND, поскольку четвертый (AGG) и шестой (CCT) кодоны в эпитопе PND являются редкими кодонами в E. coli (Икемура, 1981; Андерссон и Шарп, 1996). В отличие от других микобактериальных промоторов, которые заметно отличаются от промоторов E.coli промотор Cpn10 имел E. coli -подобных последовательностей –10 и –35 и был способен экспрессировать lacZ в E. coli , что указывает на высококонсервативную природу промоторов теплового шока у разных видов (Baird и др. , 1989; Стюарт и др. , 2002). Гомологичный промотор показал высокий уровень экспрессии по сравнению с гетерологичным промотором в Mycobacterium smegmatis . Кроме того, неспособность производных pMV206 образовывать колонии в M.smegmatis может быть результатом токсических эффектов, связанных с многокопийной экспрессией химерного антигена под контролем сильного промотора Cpn10. Таким образом, в этом исследовании был идентифицирован ранее не охарактеризованный микобактериальный промотор с сильной промоторной активностью как в E. coli , так и в микобактериях, который может служить идеальным кандидатом для конструирования векторов экспрессии микобактерий.

    На мышах оценивали как клеточный, так и гуморальный иммунный ответ, индуцированный р-БЦЖ.Значительная пролиферация наблюдалась после стимуляции gp120 и PND, что указывает на активацию лимфоцитов. Качественная и количественная разница в поляризации Th-1 и Th-2 Т-клеток является важным фактором, определяющим фенотипы защиты по сравнению с восприимчивостью как при инфекционных, так и при неинфекционных заболеваниях (аутоиммунитет и рак) (Romagnani, 1996). In vitro секреция цитокинов показала сильную поляризацию Th-2 в группе r-BCG. Слабый ответ DTH против пептида PND может быть результатом сильной поляризации Th-2, индуцированной r-BCG.IL-4 представляет собой плеотрофный цитокин, который вместе с IL-13 участвует в дифференцировке Th-2 и продукции антител (McKenzie, 2000). Это вызывает пролиферацию B-клеток, дифференцировку плазматических клеток, переключение класса изотипа, исключение аллелей и созревание аффинности. Некоторые из его независимых от антител эффектов включают активацию молекул главного комплекса гистосовместимости (MHC) класса II и B7 на В-клетках, апоптоз моноцитов (приводящий к перекрестной презентации антигенов), ингибирование индуцибельной синтазы оксида азота (iNOS), активацию сосудистых клеток. молекула адгезии-1 (VCAM-1) и подавление E-селектина (Paul, 1991).Наши результаты показывают, что даже несмотря на то, что БЦЖ является мощным индуктором ответа Th-1, она содержит несколько «детерминант Th-2», которые при гиперэкспрессии могут склонить чашу весов в сторону Th-2. Недавно Rao (2005) сообщил о сильной поляризации Th-2 за счет повышенной экспрессии гликолипопротеина Mycobacterium tuberculosis 19 кДа в r-BCG.

    Образование эффекторных Т-клеток / Т-клеток памяти является важным защитным иммунным коррелятом, определяющим эффективность вакцин (Robinson & Amara, 2005).Наивные клетки экспрессируют относительно высокие уровни CD45RB и CD62L. При активации они становятся CD44 высокими CD45RB низкими CD62L низкими Т-клетками памяти. CD45RB имеет решающее значение для активации Т-клеточного рецептора (TCR) и быстро подавляется при лигировании TCR (Croft et al. , 1994). Кроме того, низкий уровень экспрессии этой молекулы в Т-клетках CD4 + иногда связан с фенотипом Th-2, и относительный баланс между CD45RB высокий и CD45RB низкий Т-клетки, по-видимому, важен для определения Th. -1 vs.Поляризация Th-2 (Watkins et al. , 1996). В настоящем исследовании значительное увеличение процента CD3 + CD45RB low Т-клеток было замечено в группах BCG и r-BCG, которые подверглись пролиферации после стимуляции пептидом PND. Независимо от того, являются ли эти клетки Th-2 поляризованными клетками или эффекторными клетками / клетками памяти, необходимо дальнейшее экспериментирование.

    Одна из основных проблем при индукции широко нейтрализующих V3-специфических антител заключается в разработке вектора, который представляет эпитоп в конформационно правильной форме.Fomsgaard (1998) сообщил, что ДНК-вакцина, кодирующая эпитоп PND, вставленная в высокоиммуногенный поверхностный антиген гепатита B, вызвала быстрый и высокотитровый ответ антител против эпитопа PND. В настоящем исследовании группа r-BCG вызвала сильный антительный ответ против эпитопа PND, что указывает на правильный процессинг и представление чужеродного эпитопа иммунной системе. Неспособность r-BCG индуцировать IgA или IgM ожидается, поскольку подкожный способ инокуляции направляет иммуноген на дермальные дендритные клетки, которые, в свою очередь, заставляют В-клетки секретировать IgG.Кроме того, ревакцинация могла вызвать переключение класса с IgM на IgG. Наблюдаемый сильный антительный ответ может быть результатом использованного антигена-носителя (Cpn10) или эпитопа PND. Однако влияние антигена-носителя против эпитопа PND на определение результата иммунного ответа еще предстоит оценить.

    Настоящая система доставки эпитопа имеет большое применение при заболеваниях, при которых, как известно, ответы Th-2 являются защитными. Опосредованная антителами защита от некоторых вирусных, бактериальных (внеклеточных) и глистных инфекций хорошо известна (Del Prete & Romagnani, 1994).Традиционно многие штаммы r-BCG, экспрессирующие цитокины, были разработаны, чтобы вызвать иммунную поляризацию (Murray et al. , 1996). Основное беспокойство по поводу живых вакцин, экспрессирующих иммуномодификаторы, связано с полным отключением иммунитета Th-1 или Th-2 (в зависимости от выраженного цитокина) и биологической локализацией. Например, экспрессирующий IL-4 вирус осповакцины убивал всех иммунизированных мышей, полностью подавляя клеточно-опосредованные иммунные ответы (Stanford & McFadden, 2005).Таким образом, эффективная вакцина должна вызывать соответствующий иммунный ответ против конкретных эпитопов, тем самым делая иммунный ответ более целенаправленным и специфичным. Конъюгирование эпитопов с антигенами, которые обладают известными поляризационными эффектами, и их экспрессия в носителе живой вакцины является идеальной стратегией в обратной вакцинологии для разработки вакцин на основе эпитопов. В этом отношении настоящая система доставки эпитопа индуцировала сильную поляризацию Th-2 и активацию Т-клеток, а также увеличивала продукцию антител против чужеродного эпитопа, что делало ее идеальным кандидатом для обратной вакцинологии.

  • 162"> Благодарности
  • Мы благодарим доктора В. Д. Раманатана за гистопатологический анализ и г-на Анбалагана за анализ сортировки клеток с активацией флуоресценции (FACS). VA благодарит Совет по научным и промышленным исследованиям (CSIR) Индии за стипендию для старших исследователей и благодарит Программу международных инициатив по обучению и исследованиям в области СПИДа (AITRP) (D43TW01403) Медицинского колледжа Альберта Эйнштейна, Университет Йешива, Бронкс, Нью-Йорк для стипендий приезжих студентов.

  • 164"> Список литературы
  • (

    2002

    )

    Профилактическое введение Mycobacterium tuberculosis 10-кДа белка теплового шока (hsp10) подавляет адъювантный артрит у крыс Lewis

    .

    Int Immunopharmacol

    2

    :

    463

    -

    474

    .

    (

    1991

    )

    Гуморальные и клеточно-опосредованные иммунные ответы на живые рекомбинантные вакцины БЦЖ-ВИЧ

    .

    Природа

    351

    :

    479

    -

    482

    .

    (

    1996

    )

    Использование кодонов в комплексе Mycobacterium tuberculosis

    .

    Микробиология

    142

    :

    915

    -

    925

    .

    (

    2004

    )

    Долгосрочная эффективность вакцины БЦЖ у американских индейцев и коренных жителей Аляски: 60-летнее последующее исследование

    .

    J Am Med Assoc

    291

    :

    2086

    -

    2091

    .

    (

    1989

    )

    Клонирование и анализ последовательности гена антигена 10 кДа Mycobacterium tuberculosis

    .

    J Gen Microbiol

    135

    :

    931

    -

    939

    .

    (

    1992

    )

    Иммунореактивность антигена массой 10 кДа Mycobacterium tuberculosis

    .

    Дж Иммунол

    148

    :

    1835

    -

    1840

    .

    (

    1995

    )

    Белок массой 12 кДа Mycobacterium tuberculosis защищает мышей от экспериментальной защиты от аутоиммунного энцефаломиелита в отсутствие общих эпитопов Т-клеток с энцефалитогенными белками.

    .

    Дж Иммунол

    154

    :

    2939

    -

    2948

    .

    (

    2004

    )

    Единичная интраназальная слизистая оболочка Mycobacterium bovis Вакцинация БЦЖ обеспечивает улучшенную защиту по сравнению с подкожной вакцинацией против туберкулеза легких

    .

    Infect Immun

    72

    :

    238

    -

    246

    .

    (

    2004

    )

    БЦЖ в низких дозах в качестве адъювантной терапии поверхностного рака мочевого пузыря и обзор литературы

    .

    Aust N Z J Surg

    74

    :

    569

    -

    572

    .

    (

    1994

    )

    Наивный ответ Т-клеток памяти CD4 на антиген. Клетки памяти в меньшей степени зависят от костимуляции дополнительных клеток и могут отвечать на многие типы антигенпрезентирующих клеток, включая покоящиеся В-клетки

    .

    Дж Иммунол

    152

    :

    2675

    -

    2685

    .

    (

    2001

    )

    Экспрессия В-клеточных и Т-клеточных эпитопов нуклеопротеина вируса бешенства в Mycobacterium bovis BCG и индукция гуморального ответа у мышей

    .

    Вакцина

    20

    :

    731

    -

    736

    .

    (

    2005

    )

    Факторы, влияющие на иммунный ответ на чужеродный антиген, экспрессируемый в рекомбинантных вакцинах БЦЖ

    .

    Вакцина

    23

    :

    1209

    -

    1224

    .

    (

    1998

    )

    Улучшенные гуморальные и клеточные иммунные ответы против gp120 V3 петли ВИЧ-1 после генетической иммунизации химерной ДНК-вакциной, кодирующей V3, вставленную в поверхностный антиген гепатита B

    .

    Scand J Immunol

    47

    :

    289

    -

    295

    .

    (

    1998

    )

    Система доставки эпитопа для использования с рекомбинантными микобактериями

    .

    Infect Immun

    66

    :

    3643

    -

    3648

    .

    (

    1981

    )

    Корреляция между численностью РНК-переносчика Escherichia coli и наличием соответствующих кодонов в ее белковых генах

    .

    Дж Мол Биол

    146

    :

    1

    -

    21

    .

    (

    1990

    )

    Создание системы секреции чужеродного антигена у микобактерий

    .

    Infect Immun

    58

    :

    4049

    -

    4054

    .

    (

    2000

    )

    Регулирование клеточного иммунитета Т-хелперов 2 типа интерлейкином-4 и интерлейкином-13

    .

    Pharmacol Ther

    88

    :

    143

    -

    151

    .

    и другие. . (

    1992

    )

    Главный Т-клеточный антиген Mycobacterium leprae представляет собой родственный белок

    теплового шока массой 10 кДа.

    J Exp Med

    175

    :

    275

    -

    284

    .

    (

    1984

    )

    Иммунологическая оценка компонента, выделенного из Mycobacterium bovis BCG, с использованием моноклонального антитела к M. bovis BCG

    .

    Infect Immun

    46

    :

    519

    -

    525

    .

    (

    1996

    )

    Манипуляция и усиление антимикобактериального иммунитета с использованием штаммов рекомбинантной бациллы Кальметта – Герена, которые секретируют цитокины

    .

    Proc Natl Acad Sci USA

    93

    :

    934

    -

    939

    .

    (

    1991

    )

    Интерлейкин-4: прототипный иммунорегуляторный лимфокин

    .

    Кровь

    77

    :

    1859

    -

    1870

    .

    (

    1994

    )

    Роль субпопуляций Th2 и Th3 в инфекционных заболеваниях человека

    .

    Trends Microbiol

    2

    :

    4

    -

    6

    .

    и другие. . (

    2005

    )

    Повышенная экспрессия Mycobacterium tuberculosis 19 кДа липопротеинов нивелирует защитную эффективность БЦЖ за счет поляризации иммунных ответов хозяина на подтип Th3

    .

    Scand J Immunol

    61

    :

    410

    -

    417

    .

    (

    2001

    )

    Применение нейронной сети с временной задержкой для аннотации промотора в геноме Drosophila melanogaster

    .

    Comput Chem

    26

    :

    51

    -

    56

    .

    (

    1998

    )

    Консервативная структура гликопротеина gp120 ВИЧ, участвующая в связывании хемокинового рецептора

    .

    Наука

    280

    :

    1949

    -

    1953

    .

    (

    2005

    )

    Т-клеточные вакцины против микробных инфекций

    .

    Nat Med

    11

    :

    S25

    -

    S32

    .

    (

    1996

    )

    Th2 и Th3 при болезнях человека

    .

    Clin Immunol Immunopathol

    80

    :

    225

    -

    235

    .

    (

    2005

    )

    «Супервирус»? Уроки поксвирусов, экспрессирующих IL-4

    .

    Trends Immunol

    26

    :

    339

    -

    345

    .

    (

    2002

    )

    Изучение реакции теплового шока у Mycobacterium tuberculosis с использованием мутантов и микрочипов

    .

    Микробиология

    148

    :

    3129

    -

    3138

    .

    и другие. . (

    1991

    )

    Новое применение БЦЖ для рекомбинантных вакцин

    .

    Природа

    351

    :

    456

    -

    460

    .

    (

    2002

    )

    Структура Mycobacterium tuberculosis шаперонин-10 при разрешении 3,5 A

    .

    Acta Crystallogr D: Биол Crystallogr

    58

    :

    260

    -

    266

    .

    (

    1996

    )

    Электропорация при повышенных температурах существенно повышает эффективность трансформации медленнорастущих микобактерий

    .

    FEMS Microbiol Lett

    145

    :

    101

    -

    105

    .

    и другие. . (

    1996

    )

    Фенотипический анализ эозинофилов и лимфоцитов дыхательных путей в мышиной модели воспаления легких, управляемой Th-2

    .

    Am J Respir Cell Mol Biol

    15

    :

    20

    -

    34

    .

    (

    1985

    )

    Кассетный мутагенез: эффективный метод генерации множественных мутаций в определенных сайтах

    .

    Gene

    34

    :

    315

    -

    323

    .

    Заметки автора

    © 2006 Федерация европейских микробиологических обществ

    STRO-001 - Основные публикации | Sutro Biopharma, Inc.

    Pan Pacific Lymphoma, 2018

    ВЫСОКАЯ ЧАСТОТА ЭКСПРЕССИИ CD74 ПРИ В-КЛЕТОЧНОЙ ЛИМФОМЕ НЕХОДЖКИНА (НХЛ) И НАПРАВЛЕНИЕ СТРО-001, НОВАЯ КОНЪЮГАТА АНТИ-CD74-АНТИТЕЛЛА (ADC) С ПОТЕНЦИАЛЬНЫМ АНТИКОДОМ В ВИТРО- В ВИТРО-906 ДЕЯТЕЛЬНОСТЬ

    A Yu 1 , C Abrahams 1 , M Embry 1 , X Li 1 , S Zhao 2 , R Henningsen 1 , V DeAlmeida 1 , S Matheny T Клайн 1 , A Yam 1 , R Stafford 1 , Y Natkunam 2 , T Hallam 1 , M Lupher 1 , A Molina 1

    1 Sutro Biopharma, 2 Кафедра патологии Стэнфордского университета

    Цель:

    Получение и анализ STRO-001, нового гомогенного конъюгата антитело-лекарство (ADC), состоящего из человеческого агликозилированного антитела IgG1 к CD74 (SP7219) с сайт-специфической конъюгацией нерасщепляемого майтансиноидного линкера-боеголовки.CD74 является привлекательной мишенью для лечения В-клеточных злокачественных новообразований.

    Методы:

    Образцы тканей из отделения патологии Стэнфордского университета были использованы для оценки экспрессии CD74 биотинилированным SP7219 с помощью иммуногистохимии (IHC). Аффинность связывания SP7219 с рекомбинантным человеческим CD74 ECD (внеклеточный домен) и CD74 ECD яванского макака (cyno) измеряли с использованием Biacore T200. Проточную цитометрию использовали для измерения экспрессии CD74 в клеточных линиях NHL.STRO-001 использовали для определения EC 50 и процентного диапазона киллинга в клеточных линиях NHL. Была исследована противоопухолевая активность STRO-001 в ксенотрансплантатах NHL у мышей с тяжелым комбинированным иммунодефицитом (SCID).

    Результаты:

    Анти-CD74-антитело SP7219 связывается как с CD74 ECD человека, так и с CD74 cyno с высокой аффинностью (K D = 0,85 нМ для человека, K D = 2,4 нМ для cyno). Экспрессия CD74 наблюдалась в 404/423 (96% ) всех протестированных В-клеточных лимфом: 135/140 (96%) диффузная крупноклеточная B-лимфома (DLBCL), 148/151 (98%) фолликулярная лимфома и 19/21 (90%) лимфома из мантийных клеток (MCL), 32 / 35 (91%) лимфома маргинальной зоны, 36/36 (100%) мелкая лимфоцитарная лимфома / хронический лимфолейкоз и 5/5 (100%) лимфоплазмоцитарная лимфома образцов. In vitro Анализы цитотоксичности показывают сильную активность STRO-001 в разнообразной панели линий B-клеточных опухолей со значениями EC 50 в диапазоне 0,17-13 нМ. STRO-001 проявляет дозозависимое ингибирование роста опухоли в ксенотрансплантатах SU-DHL-6, устойчивых к ритуксимабу, зародышевых центров, подобных В-клеткам (GCB) -DLBCL. STRO-001 + бендамустин / ритуксимаб (BR) дополнительно улучшает подавление опухоли в ксенотрансплантатах SU-DHL-6 по сравнению с носителем (p = 0,002) или одним BR (p = 0,02). В модели активированных B-клеток (ABC) -DLBCL U2932 однократные дозы STRO-001 вызывают дозозависимое ингибирование роста при 1 и 3 мг / кг и полную регрессию опухоли при 10 мг / кг у 7/7 животных без опухоли. повторный рост до> 90 дней после лечения.Исследования с моделью MCL, Jeko-1, демонстрируют сильную противоопухолевую активность STRO-001 по сравнению с носителем (p <0,0001), начиная с однократной дозы 3 мг / кг, с однократной дозой 10 мг / кг, приводящей к регрессии опухоли для до 64 дней после лечения. Обработка STRO-001 через 14 дней после инокуляции опухоли была использована для оценки прогрессирования заболевания в модели диссеминированной MCL Mino. У животных, получавших носитель, развилось серьезное заболевание со средней выживаемостью 81 день. Напротив, все ксенотрансплантаты Mino, обработанные STRO-001 в дозе 3 мг / кг или 10 мг / кг, были живыми и здоровыми при умерщвлении через 135 дней после инокуляции опухоли.

    Выводы:

    CD74 экспрессируется с высокой частотой и интенсивностью в DLBCL, фолликулярной лимфоме и MCL, что поддерживает исследования новых биологических препаратов, нацеленных на этот антиген. STRO-001 демонстрирует сильную цитотоксичность in vitro в нескольких клеточных линиях NHL и противоопухолевую активность в моделях ксенотрансплантатов GCB-DLBCL, ABC-DLBCL и лимфомы из мантийных клеток, включая продление выживаемости в диссеминированной модели Mino MCL и предотвращение повторного роста опухоли. в подкожных моделях U2932 ABC-DLBCL и Jeko-1 MCL.Клинические исследования этого нового ADC для лечения В-клеточных злокачественных новообразований продолжаются.

    Плакат ASCO 2018 по продолжающимся испытаниям

    J Clin Oncol 36, 2018 (Suppl; abstr TPS7586)

    Фаза 1 открытое исследование безопасности, фармакокинетики и предварительной эффективности STRO-001, конъюгата анти-CD74 и лекарственного средства, у пациентов с распространенными В-клеточными злокачественными новообразованиями.

    Амрита Ю. Кришнан, Нина Шах, Александр И. Спира, Джонатан Л. Кауфман, Рубен Несвицкий, Нирав Ниранджан Шах, Джон М.Берк, Лесли Попплуэлл, Томас Г. Мартин, Джули Чунг, Шеннон Л. Матени, Джон Пол Леонард, Артуро Молина; Город Надежды, Дуарте, Калифорния; Калифорнийский университет, Сан-Франциско, Сан-Франциско, Калифорния; Специалисты по раку Вирджинии, Фэрфакс, Вирджиния; Институт рака Уиншипа Университета Эмори, Атланта, Джорджия; Пресвитерианская больница Нью-Йорка - кампус Корнелл, Нью-Йорк, штат Нью-Йорк; Медицинский колледж Висконсина, Милуоки, Висконсин; Онкологические центры Скалистых гор, Аврора, Колорадо; Калифорнийский университет в Сан-Франциско, Сан-Франциско, Калифорния; Сутро Биофарма, Южный Сан-Франциско, Калифорния; Сутро Биофарма, Южный Сан-Франциско, Калифорния; Медицинский колледж Вейлла Корнелла, Нью-Йорк - пресвитерианская больница, Нью-Йорк,

    Справочная информация:

    Система производства бесклеточных антител

    Sutro была использована для изготовления STRO-001, нового конъюгата антитело-лекарственное средство, нацеленного на CD74.CD74 экспрессируется на В-клетках на протяжении всей дифференцировки и является привлекательной мишенью для лечения злокачественных новообразований В-клеток. STRO-001 демонстрирует сильную цитотоксичность в клеточных линиях неходжкинской лимфомы (NHL) и множественной миеломы (MM) и противоопухолевую активность на моделях ксенотрансплантатов. Токсикологические исследования демонстрируют дозозависимое истощение B-клеток и обратимую гематологическую токсичность при введении STRO-001 в дозе до 10 мг / кг.

    Методы:

    Это исследование - первое открытое многоцентровое исследование фазы 1 с участием людей с увеличением дозы (Часть 1) с увеличением дозы (Часть 2) для определения максимально переносимой дозы (MTD), рекомендуемые дозы фазы 2 (RP2D) и для оценки безопасности, переносимости и предварительной противоопухолевой активности STRO-001 у взрослых с В-клеточными злокачественными новообразованиями (ММ и НХЛ), которые невосприимчивы к любой терапии, которая, как известно, обеспечивает клиническую пользу, или не переносит их.STRO-001 вводится всем пациентам, участвующим в исследовании, путем внутривенной инфузии в день 1 и день 15 каждого цикла до прогрессирования заболевания. Токсичность, ограничивающая дозу, будет оцениваться в первом цикле (1-28 дни) повышения дозы. В Части 1 2 когорты (1 для ММ и 1 для НХЛ) будут набирать по 30 пациентов для определения MTD и RP2D для расширения, в то время как в Части 2 будут зарегистрированы 4 когорты на основе подтипов заболевания (MM, диффузные большие B-клетки, мантийные клетки и фолликулярные лимфомы). Эффективность будет оцениваться по критериям, специфичным для MM или NHL.Ключевые критерии включения включают рецидивирующее или рецидивирующее / рефрактерное заболевание, адекватную функцию костного мозга и почек, а также способность соблюдать режимы лечения, тестирования и фармакокинетики (ФК). Пациенты с НХЛ должны иметь по крайней мере одно поддающееся измерению поражение. Ключевые критерии исключения включают лейкемические проявления лимфомы, необходимость постоянного приема антикоагулянтов или иммунотерапии, включая системные кортикостероиды, и наличие в анамнезе поражения ЦНС. Будут собраны образцы для оценки PK и иммуногенности. В этом исследовании не будет проводиться формальная статистическая проверка гипотез.Это исследование в настоящее время открыто для зачисления в США. Информация о клиническом испытании: NCT03424603

    https://meetinglibrary.asco.org/record/165482/abstract

    EHA, НХЛ, 2017

    STRO-001, НОВЫЙ КОНЬЮГАТ АНТИ-CD74 АНТИТЕЛ (ADC) ДЛЯ ЛЕЧЕНИЯ В-КЛЕТОЧНОЙ НЕХОДЖКИНСКОЙ ЛИМФОМЫ (НХЛ)

    Автор (ы): Эбигейл Ю, Кристина Абрахамс, Миллисент Эмбри, Сяофан Ли, Венита ДеАлмейда, Джон Ли, Шеннон Матени, Тони Клайн, Элис Ям, Райан Стаффорд, Тревор Халлам, Марк Люфер, Артуро Молина

    Справочная информация:

    CD74 представляет собой трансмембранный гликопротеин типа II, участвующий в образовании и транспорте белка MHC класса II.CD74 быстро интернализируется и высоко экспрессируется во многих злокачественных новообразованиях B-клеток с ограниченной экспрессией в нормальных тканях (Stein R. et al., CCR 2007). STRO-001 - это новый ADC, нацеленный на CD74, состоящий из п-азидо-метилфенилаланина (pAMF) -содержащего анти-CD74-агликозилированного человеческого IgG1-антитела (SP7219), конъюгированного с нерасщепляемым дибензоциклооктином (DBCO) -майтансиноидным линкером-боеголовкой. . Высокоэффективная сайт-специфическая конъюгация, обеспечиваемая бесклеточной продукцией антител Sutro и щелочной химией, давала четко определенный гомогенный ADC с соотношением лекарственное средство-антитело (DAR), равным 2.Из-за своей ограниченной проницаемости для клеток основной катаболит, высвобождаемый STRO-001, имеет в 1000 раз более низкую активность в отношении CD74-положительных и отрицательных клеток по сравнению с эталонным цитотоксическим майтанзином. Поскольку сайты конъюгации были выбраны на основе наивысшей стабильности как i n vitro, так и in vivo , тем самым ограничивая потерю лекарственной части из STRO-001 в циркуляции, этот новый ADC имеет потенциал для улучшения профилей PK, безопасности и активности.

    Цели:

    Целью этого исследования было изучить терапевтический потенциал STRO-001 в клеточных линиях и ксенотрансплантатах неходжкинской лимфомы (NHL).Исследовательское токсикологическое исследование с увеличением дозы было также проведено на яванских макаках.

    Методы:

    Биотинилированный SP7219 использовали для иммуногистохимии (IHC). Конъюгированный с DBCO-Alexa647 SP7219 и проточную цитометрию использовали для обнаружения и количественного определения экспрессии CD74 на линиях клеток NHL и B-клетках от нормальных доноров-людей. STRO-001 использовали для определения EC 50 и процентного диапазона киллинга в клеточных линиях NHL. Исследовали противоопухолевую активность STRO-001 у мышей SCID, несущих ксенотрансплантаты опухолевых клеток NHL.STRO-001 вводили макакам cynomolgus в рамках экспериментального исследования с увеличением дозы повторных внутривенных доз 1, 3, 10 и 30 мг / кг в дни 1 и 15.

    Результаты:

    Экспрессия CD74 в различных подтипах лимфом оценивалась с помощью ИГХ на дублированных биоптатах ядра (согласованной пары). Экспрессия CD74 от средней до высокой в> 70% клеток наблюдалась в образцах 86/100 диффузных больших B-клеток (DLBCL), 22/28 фолликулярной лимфомы и 49/78 лимфомы из мантийных клеток (MCL). In vitro Анализы цитотоксичности демонстрируют сильную активность STRO-001 в разнообразной панели линий B-клеточных опухолей, включая 9 диффузных B-клеточных лимфомов зародышевого центра (GCB), диффузных больших B-клеток (DLBCL), 3 активированных B-клеток (ABC). ) DLBCL и 4 клеточные линии лимфомы клеток мантии (MCL) со значениями EC 50 в диапазоне от 0.17-13 нМ. STRO-001 оказывает лишь умеренное воздействие на наивные B-клетки, но демонстрирует более сильное уничтожение клеток в активированных B-клетках человека, которые имеют повышенную экспрессию CD74 (аналогичная экспрессия CD74, как у линии клеток SU-DHL-6). Экспрессия CD74 на клеточной поверхности необходима для цитотоксической активности STRO-001, но уровень экспрессии, измеренный по способности связывания антител, не коррелирует с эффективностью in vitro (R 2 = 0,4154). STRO-001 проявляет дозозависимое ингибирование роста опухоли в устойчивых к ритуксимабу ксенотрансплантатах SU-DHL-6, начиная с 2.5 мг / кг еженедельно x 3 приема. Стандартная комбинация бендамустина / ритуксимаба (BR) + STRO-001 дополнительно улучшает подавление опухоли в ксенотрансплантатах SU-DHL-6 по сравнению с носителем (p = 0,002) или одним BR (p = 0,02). Исследования с использованием модели ксенотрансплантата MCL, Jeko-1, демонстрируют сильную противоопухолевую активность по сравнению с носителем (p <0,0001), начиная с однократной дозы STRO-001 3 мг / кг, с однократной дозой 10 мг / кг, приводящей к опухоли. регресс до 64 дней после лечения. Обработка STRO-001 через 14 дней после инокуляции опухоли была использована для оценки прогрессирования заболевания у Mino, модели медленно растущего диссеминированного ксенотрансплантата MCL.У животных, получавших носитель, развилось далеко зашедшее заболевание с пальпируемыми опухолями и вздутием живота со средней выживаемостью 81,3 дня. Напротив, мино-ксенотрансплантаты, обработанные STRO-001 в дозе 3 мг / кг или 10 мг / кг, продемонстрировали улучшенную выживаемость, при этом большинство животных были здоровыми и свободными от болезней во время умерщвления через 135 дней после инокуляции. STRO-001 продемонстрировал истощение В-клеток у яванских макак, подтверждая предполагаемый фармакодинамический эффект. Миелосупрессия наблюдалась при максимальной дозе, но не было доказательств токсичности, не связанной с мишенью.

    Заключение:

    STRO-001 демонстрирует сильную цитотоксичность in vitro в отношении клеточных линий NHL и противоопухолевую активность в моделях ксенотрансплантатов NHL, включая длительную выживаемость в модели диссеминированной Mino MCL. STRO-001 истощает В-клетки дозозависимым образом. Клинические исследования этого нового ADC для лечения В-клеточных злокачественных новообразований находятся в стадии разработки.

    https://learningcenter.ehaweb.org/eha/2017/22nd/181149/arturo.molina.stro-001.a.novel.anti-cd74.antibody.лекарство.конъюгат.% 28adc% 29.for.html

    EHA, MM 2017

    НАПРАВЛЕНИЕ CD74 ПРИ МНОЖЕСТВЕННОЙ МИЕЛОМЕ С НОВЫМ КОНЬЮГАТОМ АНТИТЕЛЛА (ADC), STRO-001

    Автор (ы): Миллисент Эмбри, Сяофан Ли, Венита ДеАлмейда, Кристина Абрахамс, Эбигейл Ю, Стеллани Кримм, Сара Крюгер, Шеннон Матени, Тони Клайн, Элис Ям, Райан Стаффорд, Тревор Халлам, Марк Люфер, Артуро Молина

    Справочная информация:

    CD74 представляет собой трансмембранный гликопротеин, участвующий в образовании и транспорте белка MHC.Экспрессия CD74 наблюдалась до 90% злокачественных новообразований В-клеток, включая множественную миелому (ММ), с минимальной экспрессией в нормальных тканях. CD74 быстро усваивается, что делает его привлекательной целью для АЦП. STRO-001 - это новый ADC, состоящий из агликозилированного человеческого антитела IgG1 к CD74 (SP7219), ковалентно конъюгированного с пара-азидо-метил-L-фенилаланином неприродной аминокислоты (pAMF) с нерасщепляемым дибензоциклооктином (DBCO). -майтансиноидный линкер-боеголовка. Высокоэффективная сайт-специфическая конъюгация, обеспечиваемая новым бесклеточным продуцированием антител и щелочной химией, приводит к четко определенному гомогенному лекарственному продукту ADC с соотношением лекарственное средство-антитело (DAR), равным 2.

    Цели:

    Цитотоксичность in vitro и эффективность STRO-001 in vivo исследовали на клеточных линиях ММ и ксенотрансплантатах. Исследовательское токсикологическое исследование было проведено на модели приматов, не относящихся к человеку.

    Методы:

    Окрашивание SP7219, конъюгированного с DBCO-Alexa647, и проточную цитометрию использовали для обнаружения и количественного определения экспрессии CD74 на линиях клеток MM. STRO-001 использовали для определения ЕС50 и процентного диапазона гибели в клеточных линиях ММ.Противоопухолевую активность STRO-001 оценивали на моделях диссеминированных ARP-1 и MM.1S MM. Биолюминесцентную визуализацию (BLI) in vivo животных, несущих клетки MM.1s-luc, проводили с использованием IVIS Spectrum. Изображения BLI были получены через 7, 14, 21 и 28 дней после инокуляции опухолевых клеток. STRO-001 вводили макакам cynomolgus в рамках экспериментального исследования с увеличением дозы повторных внутривенных доз 1, 3, 10 и 30 мг / кг в дни 1 и 15.

    Результаты:

    Анализы цитотоксичности in vitro показывают наномолярную активность STRO-001 в пяти линиях клеток MM: MC / CAR (EC50 0.8 нМ), ARD (EC50 6,5 нМ), MM.1S (EC50 10-11 нМ), U266B1 (EC50 8,5-9,3 нМ) и ARP-1 (EC50 4,3-22 нМ). Экспрессия CD74 на клеточной поверхности необходима для цитотоксической активности STRO-001, но уровень экспрессии, измеренный по способности связывания антител, не сильно коррелирует с эффективностью in vitro (R2 = 0,5837 для линий клеток MM). STRO-001 подавляет рост плазматических клеток CD138 + в костном мозге (BM) и образование висцеральных опухолей (p = 0,002 для почки; p <0,0001 для яичника) после 4-х недельных доз 3 мг / кг в диссеминированном MM ARP-1. модель ксенотрансплантата.STRO-001, вводимый в дозе 3 мг / кг и 10 мг / кг еженедельно x 3, также уничтожает злокачественные плазматические клетки костного мозга к 32 дню после инокуляции (p <0,0001) и продлевает выживаемость в диссеминированной модели MM.1S. По окончании исследования, через 129 дней после инокуляции, 100% животных, которым вводили STRO-001, выжили и не продемонстрировали признаков заболевания с отсутствием клеток CD138 + в их костном мозге, в то время как средняя выживаемость контрольных животных, которым вводили носитель, составляла 35 дней с почти 50% их костного мозга содержат клетки миеломы. BLI ММ, экспрессирующей люциферазу.Линии опухолевых клеток 1S (MM.1S-luc) позволили провести неинвазивное количественное определение опухолевой нагрузки. Однократные дозы 1, 3 и 10 мг / кг STRO-001 (вводимые на 7-й день после инокуляции) приводили к ликвидации миеломы к 28-му дню на основании сигнала биолюминесценции и количественного определения CD138 + клеток в костном мозге. Кроме того, STRO-001 вызывал дозозависимое снижение нормальных B-клеток у яванских макак, обеспечивая фармакодинамическое свидетельство нацеливания на B-клетки.

    Заключение:

    STRO-001 демонстрирует сильную цитотоксичность in vitro в клеточных линиях ММ и снижает опухолевую нагрузку в моделях ксенотрансплантатов ММ, включая значительное продление выживаемости в ММ.Модель 1С. Основываясь на этих обнадеживающих наблюдениях, STRO-001 поступает в клинику для лечения злокачественных новообразований, экспрессирующих CD74 B-клеток.

    https://learningcenter.ehaweb.org/eha/2017/22nd/181615/arturo.molina.targeting.cd74.in.multiple.myeloma.with.a.novel.antibody.drug.html

    ICML 2017

    Гематологическая онкология, 17 июня 2017 г., том 35, выпуск S2, стр. 255-256.

    STRO ‐ 001, НОВЫЙ КОНЬЮГАТ АНТИ-CD74 АНТИТЕЛ (ADC) ДЛЯ ЛЕЧЕНИЯ В-КЛЕТОЧНЫХ НЕХОДЖКИНСКИХ ЛИМФОМ (NHL)

    1. Молина, А.Ю., К. Абрахамс, М. Эмбри, X. Ли, В. ДеАлмейда, Дж. Ли, С. Матени, Т. Клайн, А. Ям, Р. Стаффорд, Т. Халлам, М. Люфер

    Предпосылки: CD74 представляет собой трансмембранный гликопротеин типа II, участвующий в образовании и транспорте белка MHC класса II. CD74 быстро интернализируется и высоко экспрессируется во многих злокачественных новообразованиях B-клеток с ограниченной экспрессией в нормальных тканях (Stein R. et al., CCR 2007). STRO-001 представляет собой новый ADC, нацеленный на CD74, состоящий из п-азидо-метилфенилаланина (pAMF) -содержащего анти-CD74-агликозилированного человеческого IgG1-антитела (SP7219), конъюгированного с нерасщепляемым дибензоциклооктином (DBCO) -майтанзиноидным линкером.Высокоэффективная сайт-специфическая конъюгация, доступная благодаря бесклеточной продукции антител Sutro и химии щелчков, позволила получить четко определенный гомогенный ADC с соотношением лекарственное средство-антитело (DAR), равным 2. Из-за своей ограниченной проницаемости клеток основной катаболит, выделяемый STRO- 001 имеет в 1000 раз более низкую активность по уничтожению CD74 положительных и отрицательных клеток по сравнению с эталонным цитотоксическим майтанзином. Поскольку сайты конъюгации были выбраны на основе максимальной стабильности как in vitro, так и in vivo, тем самым ограничивая потерю лекарственной части из STRO-001 в циркуляции, этот новый ADC имеет потенциал для улучшения профилей PK, безопасности и активности.Цели: Целью этого исследования было изучить терапевтический потенциал STRO-001 в клеточных линиях и ксенотрансплантатах неходжкинской лимфомы (НХЛ). Исследовательское токсикологическое исследование с увеличением дозы было также проведено на яванских макаках. Методы: биотинилированный SP7219 использовали для иммуногистохимии (IHC). Конъюгированный с DBCO-Alexa647 SP7219 и проточную цитометрию использовали для обнаружения и количественного определения экспрессии CD74 на линиях клеток NHL и B-клетках от нормальных доноров-людей. STRO-001 использовали для определения EC50 и процентного диапазона киллинга в клеточных линиях NHL.Исследовали противоопухолевую активность STRO-001 у мышей SCID, несущих ксенотрансплантаты опухолевых клеток NHL. STRO-001 вводили макакам cynomolgus в экспериментальном исследовании с увеличением дозы повторных внутривенных доз 1, 3, 10 и 30 мг / кг в дни 1 и 15. Результаты: Экспрессия CD74 в различных подтипах лимфомы оценивалась IHC на двойная основная (подобранная пара) биопсия. Экспрессия CD74 от средней до высокой в> 70% клеток наблюдалась в образцах 86/100 диффузных больших B-клеток (DLBCL), 22/28 фолликулярной лимфомы и 49/78 лимфомы из мантийных клеток (MCL).Анализы цитотоксичности in vitro показывают сильную активность STRO-001 в разнообразной панели линий B-клеток опухолей, включая 9 диффузных B-клеточных лимфом (DLBCL) зародышевого центра (GCB), 3 активированных B-клеток (ABC) DLBCL. и 4 линии клеток лимфомы из клеток мантии (MCL) со значениями EC50 в диапазоне 0,17-13 нМ. STRO-001 оказывает лишь умеренное воздействие на наивные B-клетки, но демонстрирует более сильное уничтожение клеток в активированных B-клетках человека, которые имеют повышенную экспрессию CD74 (аналогичная экспрессия CD74, как у линии клеток SU-DHL-6).Экспрессия CD74 на клеточной поверхности необходима для цитотоксической активности STRO-001, но уровень экспрессии, измеренный по способности связывания антител, не коррелирует с эффективностью in vitro (R2 = 0,4154). STRO-001 проявляет дозозависимое ингибирование роста опухоли в устойчивых к ритуксимабу ксенотрансплантатах SU-DHL-6, начиная с 2,5 мг / кг еженедельно x 3 дозы. Стандартная комбинация бендамустина / ритуксимаба (BR) + STRO-001 дополнительно улучшает подавление опухоли в ксенотрансплантатах SU-DHL-6 по сравнению с носителем (p = 0,002) или одним BR (p = 0.02). Исследования с использованием модели ксенотрансплантата MCL, Jeko-1, демонстрируют сильную противоопухолевую активность по сравнению с носителем (p <0,0001), начиная с однократной дозы STRO-001 3 мг / кг, с однократной дозой 10 мг / кг, приводящей к опухоли. регресс до 64 дней после лечения. Обработка STRO-001 через 14 дней после инокуляции опухоли была использована для оценки прогрессирования заболевания у Mino, модели медленно растущего диссеминированного ксенотрансплантата MCL. У животных, получавших носитель, развилось далеко зашедшее заболевание с пальпируемыми опухолями и вздутием живота со средней выживаемостью 81.3 дня. Напротив, мино-ксенотрансплантаты, обработанные STRO-001 в дозе 3 мг / кг или 10 мг / кг, продемонстрировали улучшенную выживаемость, при этом большинство животных были здоровыми и свободными от болезней во время умерщвления через 135 дней после инокуляции. STRO-001 продемонстрировал истощение В-клеток у яванских макак, подтверждая предполагаемый фармакодинамический эффект. Миелосупрессия наблюдалась при максимальной дозе, но не было доказательств токсичности, не связанной с мишенью. Резюме / Заключение: STRO-001 демонстрирует сильную цитотоксичность in vitro в отношении клеточных линий NHL и противоопухолевую активность в моделях ксенотрансплантатов NHL, включая пролонгированную выживаемость в модели диссеминированной Mino MCL.STRO-001 истощает В-клетки дозозависимым образом. Клинические исследования этого нового ADC для лечения В-клеточных злокачественных новообразований находятся в стадии разработки.

    DOI https://doi.org/10.1002/hon.2438_121

    AACR, 2017 MM и NHL

    «Исследования рака», том 77, приложение к выпуску 13, стр. 67

    Abstract 67: Характеристика и доклиническая разработка STRO-001, нового конъюгата антитело-лекарственное средство (ADC), нацеленного на CD74, для лечения В-клеточных злокачественных новообразований

    Кристина Абрахамс, Сяофан Ли, Венита ДеАлмейда, Миллисент Эмбри, Эбигейл Ю, Стеллани Крим, Хайди Хоффманн, Джеймс Завада, Морин Брунс, Шеннон Матени, Стюарт Басселл, Тони Клайн, Элис Ям, Райан Стаффорд, Льюпур Халлам и Марк Халлам, Молина

    Аннотация:

    CD74 представляет собой трансмембранный гликопротеин типа II, участвующий в образовании и транспорте белка MHC класса II.CD74 высоко экспрессируется во многих злокачественных новообразованиях B-клеток с ограниченной экспрессией в нормальных тканях (Stein R. et al., CCR 2007). STRO-001 представляет собой новый ADC, нацеленный на CD74, содержащий агликозилированное человеческое антитело IgG1 (SP7219) к CD74, конъюгированное с нерасщепляемым дибензоциклооктином (DBCO) -майтансиноидным линкером-боеголовкой. SP7219 был обнаружен из библиотеки Fab рибосом для отображения на основе технологии Sutro Xpress CF + ™. Высокоэффективная сайт-специфическая конъюгация, обеспечиваемая нашим бесклеточным продуцированием антител и щелочной химией, приводит к четко определенному гомогенному лекарственному продукту ADC с соотношением лекарственное средство-антитело (DAR), равным 2.Сайты конъюгации были выбраны на основе максимальной стабильности как in vitro, так и in vivo, тем самым ограничивая потерю лекарственной части из STRO-001 в кровотоке. Из-за своей ограниченной проницаемости для клеток основной катаболит, высвобождаемый STRO-001, имеет в 1000 раз меньшую активность по уничтожению CD74 положительных и отрицательных клеток по сравнению с эталонным цитотоксическим майтанзином. Анализы цитотоксичности in vitro показывают сильную активность STRO-001 в разнообразной панели линий B-клеточных опухолей, включая 4 множественной миеломы (MM), 9 B-клеток зародышевого центра (GCB), диффузную большую B-клеточную лимфому (DLBCL), 3 активированных В-клеточные (ABC) DLBCL и 3 клеточные линии лимфомы мантийных клеток (MCL) с IC50 в диапазоне от 0.17-20 нМ. Экспрессия CD74 на клеточной поверхности необходима для цитотоксической активности STRO-001, но уровень экспрессии, измеренный по способности связывания антител, не коррелирует с эффективностью in vitro (R2 = 0,4640). STRO-001 ингибирует образование висцеральных опухолей (p <0,004) и предотвращает рост CD138 + плазматических клеток в костном мозге (BM) после 4 недельных доз 3 мг / кг в модели диссеминированного MM ксенотрансплантата ARP-1. STRO-001 в дозе 3 мг / кг еженедельно × 3 также уничтожает злокачественные плазматические клетки BM (p <0,0001) и продлевает выживаемость в MM.1S диссеминированная модель (100% животных живы в возрасте> 90 дней). STRO-001 проявляет дозозависимое ингибирование роста опухоли в ксенотрансплантатах SU-DHL-6, начиная с 2,5 мг / кг еженедельно x 3 дозы. Комбинация бендамустин / ритуксимаб (BR) + STRO-001 дополнительно улучшает подавление опухоли в ксенотрансплантатах SU-DHL-6 по сравнению с носителем (p = 0,002) или одним BR (p = 0,02). Предварительные исследования с моделью ксенотрансплантата MCL, Jeko-1, демонстрируют сильную противоопухолевую активность по сравнению с носителем (p <0,0001), начиная с однократной дозы STRO-001 в 3 мг / кг, с продолжающимся стазом опухоли до 21 дня после лечения. .STRO-001 снижает нормальные B-клетки у киномологичных обезьян, обеспечивая фармакодинамическое свидетельство нацеливания на B-клетки. Основываясь на этих обнадеживающих наблюдениях, STRO-001 продвигается к исследованиям, позволяющим использовать IND для лечения злокачественных новообразований B-клеток, экспрессирующих CD74.

    DOI https://doi.org/10.1158/1538-7445.AM2017-67

    ЯСЕНЬ, 2016 ММ

    Кровь, том 128, выпуск 22 стр. 4465, 2016.

    Открытие и доклиническая разработка новых конъюгатов антитело-лекарственное средство (ADC), нацеленных на CD74, со значительной активностью в клеточных линиях множественной миеломы (MM) и моделях ксенотрансплантатов.

    Кристина Абрахамс, Сяофан Ли, Эбигейл Ю, Стеллани Кримм, Джейсон Кахана, Рама Кришна Нарла, Эрик Шварц, Джон Бойлан, Хайди Хоффманн, Александр Штайнер, Джеймс Завада, Хизер Стефенсон, Морин Брунс, Стюэнт ДеАлмейда, Шеннон Матенида, Шеннон Матенида Адам Галан, Тони Клайн, Ники Васкес, Элис Ям, Райан Стаффорд, Генри Хейнсон, Аарон Сато, Артуро Молина, Тревор Халлам и Марк Люфер младший

    Аннотация:

    CD74, также известный как инвариантная цепь, ассоциированная с HLA-DR, представляет собой трансмембранный гликопротеин типа II, высоко экспрессируемый при многих В-клеточных злокачественных новообразованиях.Ограниченная экспрессия CD74 в нормальных тканях предполагает, что он может быть подходящей мишенью ADC для этих типов опухолей. Соответственно, мы сконструировали антитело против CD74 человеческого IgG1 (SP7219), используя новые способы отображения рибосом на основе Fab. Отобранные Fab легко переформатировались и подвергались прямому скринингу на IgG с использованием уникальной высокопроизводительной платформы бесклеточного синтеза белка Sutro Xpress CF + ™. Затем мы разработали новые мощные ADC, SP7676 и SP7675 (STRO-001), состоящие из нашего свинцового антитела (SP7219), конъюгированного с нерасщепляемыми DBCO-майтанзиноидными линкерными боеголовками со средним соотношением лекарственное средство-антитело (DAR) 2.Мы использовали технологию сайт-специфической конъюгации, которая приводит к высокой степени гомогенности, характеризующейся ковалентным связыванием линкера лекарственного средства с одним определенным сайтом. Сайты для конъюгации были выбраны на основе максимальной активности и стабильности уничтожения клеток in vitro и in vivo. Оба ADC демонстрируют мощную активность в отношении уничтожения клеток в нескольких линиях B-клеток опухолей in vitro и противоопухолевую активность на доклинических моделях ксенотрансплантатов множественной миеломы. Анализы цитотоксичности in vitro показывают наномолярную активность STRO-001 в четырех клеточных линиях ММ: Mc / CAR (IC50 0.8 нМ), MM.1S (IC50 10-11 нМ), U266B1 (IC50 8,5-9,3 нМ) и ARP-1 (IC50 4,3-22 нМ). Экспрессия CD74 на поверхности клеток необходима для антипролиферативного действия ADC, но уровень экспрессии, по-видимому, не коррелирует с эффективностью in vitro. SP7676 вызывал устойчивый противоопухолевый ответ на модели ксенотрансплантата множественной миеломы ANBL-6. Устойчивый регресс наблюдался у всех мышей при ≥ 3 мг / кг с эквивалентной эффективностью (регресс) при 3 мг / кг (каждые 3 дня x5) и 10 мг / кг (каждые 3 дня x5 или еженедельно x3). SP7676 также продемонстрировал явное улучшение выживаемости на модели ксенотрансплантата CAG с диссеминированной множественной миеломой, начиная с 1 мг / кг каждые 3 дня × 5 доз.Аналогичным образом, как SP7676, так и STRO-001 ингибировали образование внутренних висцеральных опухолей в модели ксенотрансплантата ARP-1 после 3-х недельных доз 3 мг / кг. Планируется оценка нашего ведущего кандидата, STRO-001 в дополнительных линиях клеток MM и первичных образцах пациентов. Переносимость STRO-001 у приматов, кроме человека, находится в стадии оценки. STRO-001 вводили cynomolgous обезьянам в исследовательском исследовании с увеличением дозы до 30 мг / кг x 2 дозы в день 1 и 15. STRO-001 снижает нормальные популяции B-клеток на ≥1 мг / кг после однократной дозы, обеспечение фармакодинамических доказательств нацеливания на В-клетки, в то время как другие гематопоэтические клоны в основном затрагиваются только при максимальной изученной дозе.Ожидаемая гематологическая токсичность была легко обратимой при дозах 1, 3 и 10 мг / кг, и были идентифицированы представляющие интерес органы-мишени. Основываясь на этих обнадеживающих данных, STRO-001 продвигается к исследованиям, позволяющим использовать IND для лечения множественной миеломы, экспрессирующей CD74, и других В-клеточных злокачественных новообразований.

    ЯСЕНЬ, 2016 НХЛ

    Кровь, том 128, выпуск 22 стр. 464, 2016.

    Нацеливание на CD74 с помощью новых конъюгатов антитело-лекарство (ADC) для лечения В-клеточной неходжкинской лимфомы (NHL)

    Сяофан Ли, Кристина Абрахамс, Миллисент Эмбри, Эбигейл Ю, Джейсон Кахана, Майкл Браун, Рама Кришна Нарла, Лео Барнс, Эрик Шварц, Джон Бойлан, Джеймс Завада, Хизер Стефенсон, Морин Брюнс, Стюарт Басселл, Александр Штайнер, Адам Галан, Тони Клайн, Элис Ям, Райан Стаффорд, Хайди Хоффманн, Шеннон Матени, Венита ДеАлмейда, Ники Васкес, Генри Хейнсон, Аарон Сато, Артуро Молина, Тревор Халлам и Марк Люфер-младший.

    Аннотация:

    CD74 представляет собой трансмембранный гликопротеин типа II, участвующий в образовании и транспорте белка MHC класса II. Высокая экспрессия CD74 была подтверждена при фолликулярной лимфоме, диффузной большой B-клеточной лимфоме (DLBCL), хроническом лимфоцитарном лейкозе (CLL) / малой лимфоцитарной лимфоме (SLL) и других типах NHL с помощью иммуногистохимии (IHC) с использованием антител LL1 (Stein и др. Clin Cancer Res 2007). Мы использовали технологию сайт-специфической конъюгации для создания новых ADC, нацеленных на CD74, SP7676 и SP7675 (STRO-001), которые демонстрируют высокую степень гомогенности, характеризующуюся ковалентным связыванием линкера лекарственного средства с одним определенным сайтом.Человеческое антитело IgG1 к CD74 (SP7219), используемое для ADC SP7676 и STRO-001, было сконструировано с использованием новых методов отображения рибосом на основе Fab, позволяющих производить отбор из ~ 1012 различных вариантов антител. Сотни уникальных Fab из этой выборки были преобразованы в IgG и экспрессированы непосредственно на запатентованной платформе бесклеточного синтеза белка Sutro, Xpress CF + ™, для обширного скрининга. Ведущее антитело, полученное в результате этого скрининга, дополнительно тестируется для определения лучших сайтов для конъюгации линкерных боеголовок.Sutro SP7219 оказался наиболее эффективным антителом и был конъюгирован с нерасщепляемыми DBCO-майтанзиноидными линкерными боеголовками с образованием ADC SP7676 и STRO-001. Поскольку сайты конъюгации были выбраны на основе максимальной стабильности как in vitro, так и in vivo, эти новые ADC теряют небольшую часть лекарственного средства в кровотоке и имеют потенциал для улучшения профилей PK, безопасности и активности. Анализы пролиферации / цитотоксичности клеток in vitro показывают сильную активность в 1) линиях DLBCL (зародышевый центр, подобный B-клеткам [GCB] и «двойное попадание»): SU-DHL-4, IC50 - 1 нМ; СУ-DHL-6, IC50 - 0.4 нМ; WSU-NHL, IC50 - 1,6 нМ; Пфайффер, IC50 - 0,09 нМ; НУДУЛ-1, IC50 - 0,4 нМ; HT, IC50 - 0,7 нМ; OCI-LY-19, IC50 - 0,7 нМ; WSU-DLBCL2, IC50 - 0,3 нМ; 2) линии клеток лимфомы из клеток мантии (MCL): Mino, IC50 - 0,4-0,7 нМ; JVM-2, IC50 - 1,7-2,9 нМ; Jeko-1, IC50 - 0,4 - 0,6 нМ; 3) Ph + острый лимфобластный лейкоз (ALL): SUP-B15, IC50 - 3,9-4,6 нМ; и 4) CLL (трансформированный EBV): JVM-13, IC50 - 3,0-3,4 нМ. SP7676 вызывал сильный противоопухолевый ответ на модели ксенотрансплантата лимфомы OCI-LY-10, при этом 100% животных достигали полной регрессии опухолей при дозе 3 мг / кг каждые 3 дня x 5 доз и 10 мг / кг еженедельно x 3 дозы.В модели ксенотрансплантата лимфомы WSU-DLCL2 с «двойным попаданием» введение SP7676 (с повторным дозированием во время повторного роста) приводило к регрессу опухоли в дозе 10 мг / кг каждые 3 дня x 5 (6/8 мышей без опухолей, оставшиеся 2 с небольшими опухолями) и 10 мг / кг еженедельно x 3 (регресс опухоли у большинства животных, 4/8 без опухолей). Кроме того, STRO-001 проявляет дозозависимое ингибирование роста опухоли в ксенотрансплантатах SUDHL-6, начиная с 2,5 мг / кг еженедельно x 3 дозы. Исследовательское тестирование нашего ведущего кандидата, STRO-001 на киномологичных обезьянах, показало дозозависимое истощение B-клеток при дозах 1-30 мг / кг в день 1 и 15, подтверждая предполагаемый фармакодинамический эффект.Наши предварительные данные демонстрируют, что SP7676 и STRO-001 генерируют сильную активность по уничтожению клеток во множестве линий клеток B-клеточной лимфомы / лейкемии in vitro и противоопухолевую активность в доклинических B-клеточных ксенотрансплантатах NHL. Оценка STRO-001 на других клеточных линиях и моделях ксенотрансплантатов, а также в комбинированных исследованиях продолжается. Планируются токсикологические исследования GLP и другие исследования, позволяющие использовать IND.

    Вакцинация Адсм - правила вакцинации, реакции и осложнения. Вакцина ADS: вся правда о вакцинации для детей и взрослых

    Некоторые, даже достаточно образованные люди считают, что прививки необходимы детям, и делают их в нежном возрасте.Однако информация в корне неверна и бывают ситуации, когда вакцинация является обязательной во взрослой категории пациентов. Одной из таких инъекций является АДС-М, которая предотвращает развитие дифтерии и столбняка у людей из группы риска.

    Что такое вакцина

    Буквы ADS-M представляют собой аббревиатуру, имеющую следующую расшифровку: «Дифтерийно-столбнячный анатоксин». Приставка «М» означает низкую концентрацию действующих веществ. В результате пациент получает полную вакцину, но с уменьшенным количеством активных антигенов.

    АДС-М - это инъекция, защищающая человека от таких грозных болезней, как столбняк и дифтерия. Причем взрослым вакцинация тоже необходима, как и маленьким детям, в некоторых ситуациях. Инъекция состоит из полностью очищенных токсоидов дифтерии и столбняка, адсорбированных на гидроксиде алюминия. Вещества - ослабленные возбудители грозных болезней. В то же время они могут воздействовать на организм человека, ровно настолько, чтобы иммунная система начала активно вырабатывать антитела против «пришельцев», но тоже без вреда для здоровья.

    Как укол влияет на организм?

    Большинство пациентов, когда им предлагают инъекцию, не понимают, почему они вакцинированы ADS-M. Во время укола в организм взрослого человека вводятся живые, но ослабленные токсины. Они сохраняют свои особые иммуногенные свойства, но не способны оказывать отрицательного воздействия. В результате организм обнаруживает их присутствие и начинает активно вырабатывать антитела. Впоследствии, если произойдет настоящее заражение, именно эти вещества будут бороться с возбудителем столбняка или дифтерии.

    Специалисты объяснят, что вакцинация приводит к стертой форме этого заболевания. Но разница в том, что угрозы здоровью и жизни нет, а на долгие годы человек приобретает иммунитет.

    Для кого инъекция показана на

    Показана для взрослых вакцинация ADS-M. От того, что это делается, может подробно рассказать врач. Инъекция необходима для защиты пациента от опасных проявлений столбняка и дифтерии и делается каждые десять лет жизни человека.Если рекомендованный режим нарушен и с момента последней вакцинации прошло более двадцати лет, то для полной защиты следует сделать укол дважды. В медицинской практике это выглядит так:

    • пациенту вводят вакцину, следит за его состоянием;
    • Если нет осложнений, вторую дозу вводят через сорок дней.

    Бывают ситуации, когда больной вообще никогда не вакцинировался. В этом случае отображается следующая диаграмма:

    • после осмотра делают первую инъекцию и наблюдают за реакцией;
    • при отсутствии симптомов непереносимости повторная вакцинация вводится через сорок дней;
    • Для закрепления результата важно сделать третью инъекцию за год.

    Особые случаи

    Вакцину ADS-M также можно вводить в экстренных случаях по медицинским показаниям. Если у человека диагностированы травмы и раны, в которые попала земля, и вакцинация была сделана более пяти лет назад, то укол будет обязательной процедурой.

    Людям пожилого возраста особенно необходима ревакцинация (повторные инъекции). Часто они имеют повышенную восприимчивость к инфекциям из-за снижения иммунитета. Поэтому врачи советуют этой категории пациентов не пренебрегать вакцинацией и не ссылаться на наличие хронических заболеваний.Более того, подобные патологии - прямое показание к обязательной вакцинации.


    АДС-М. Откуда вакцина и где ее делают?

    Столбнячный и дифтерийный анатоксины выпускаются в виде белой суспензии, которая при хранении разделяется на хлопья осадка и белую жидкость. Поэтому перед тем, как открыть ампулу, рекомендуется ее энергично встряхнуть до однородного состояния.

    Вакцина АДС-М имеет неоднозначные отзывы. Откуда и где делается укол, вызывают множественные споры между пациентами.Часто можно встретить отзывы от людей, утверждающих, что им делали укол в ягодицу. Другие утверждают, что вакцинация проходила под лопаткой.

    Врачи проясняют эту ситуацию и утверждают, что анатоксин АДС-М можно размещать как в лопаточной части спины, так и в ягодицах. Тем более, что есть еще и третий вариант. Укол разрешается размещать в средней трети внешней поверхности бедра. Разовая дозировка препарата составляет 0,5 мл.

    Вакцинация может вызвать аллергическую реакцию.Поэтому пациенту не рекомендуется покидать процедурный кабинет, где он находится под наблюдением, в течение получаса. Чтобы иметь возможность оказать первую помощь, в кабинете должны находиться препараты противошоковой терапии.


    Процедура вакцинации

    Требуется соблюдение определенных правил вакцинации ADS-M. От чего и куда делается укол, рассмотрено выше, процедуру должен проводить только специально обученный медицинский работник в процедурном кабинете. В этом случае следует придерживаться основных условий.

    Инъекция выполняется только одноразовым стерильным шприцем. Одновременно с вакцинацией от столбняка и дифтерии можно сделать прививку от других болезней. Однако использование БЦЖ запрещено. Также недопустимо смешивать все вещества в одном шприце. Каждая инъекция делается отдельно и в разные части тела.

    Медсестра обязана внимательно осмотреть ампулу на предмет ее пригодности перед началом процедуры. Если на флаконе нет информации о вакцине, либо он поврежден и содержимое имеет подозрительную консистенцию, то вводить ее запрещено.Важно соблюдать условия хранения и обращать внимание на сроки годности.

    Процедура проводится в условиях, полностью соответствующих требованиям антисептиков. Ампулу вскрывают, набирают в шприц и используют как единое целое. Если по каким-либо причинам не удалось использовать все содержимое, флакон утилизируют. Хранению уже не подлежит.

    Обязательно занести данные пациента в специальный регистр. Там же вводится следующая информация:

    • серийный номер вакцины;
    • дата его изготовления;
    • дата вакцинации;
    • реакция на впрыск.

    Следует внимательно следить за состоянием пациента. Если по истечении тридцати минут самочувствие не вызывает сомнений, то вы можете выписаться из больницы.

    Противопоказания к инъекциям

    АДС-М - серьезное лекарство. В инструкции четко прописаны ситуации, когда нельзя делать укол. Противопоказания для непривитых взрослых пациентов включают:

    • тяжелых заболеваний, связанных с иммунодефицитом;
    • аллергическая реакция на компоненты вакцины;
    • отрицательная реакция на предыдущую инъекцию.

    Кроме того, есть ограничения по впрыску. Необходимо отложить процедуру у женщин в период беременности и кормления грудью. Если у пациента были острые инфекционные инфекции, то назначается отмена на две недели.

    Побочные эффекты

    Вакцина АДС-М имеет довольно неоднозначные отзывы. То, что делают укол, нравится не всем пациентам. Кроме того, расположение может отличаться. Если вводится под лопатку, то пациенты жалуются на невозможность поднять руку, если в ягодице, то иногда садиться бывает больно.Ответы у всех разные. Одни ничего не чувствуют, у других жар. Частые жалобы:

    • покраснение в месте укола;
    • насморк и общее недомогание;
    • мышечная боль в месте укола.

    Однако врачи уверяют, что такая реакция на вакцину нормальная. Такие условия говорят о борьбе организма с «пришельцами» и выработке стойкого иммунитета. Обычно через некоторое время негативные симптомы проходят сами по себе.Ведь эта вакцина считается одной из менее реактогенных.


    Побочные эффекты могут быть легкими, но иногда более серьезными. Особенно важно следить за состоянием пациента в первые 48 часов. В это время часто повышается температура, в месте укола появляются покраснение и припухлость. Если появится уплотнение в форме шишки, не паникуйте. Самостоятельно растворяется в течение пары недель. Однако врачи предупреждают, что во избежание нагноения утеплять это место запрещено.

    Специалисты подчеркивают, что даже тяжелая реакция на вакцинацию не считается патологией. Никаких последствий для здоровья не будет, даже если человек в первые дни почувствует себя очень неуютно. Однако стоит учитывать возможность стойкой аллергической реакции, которая может служить противопоказанием к ревакцинации.


    Аналоги вакцин

    Вакцинация ADS-M имеет несколько аналогов. Из того, что это делается, является приоритетом выбор подходящей инъекции.Аналоги имеют схожий состав, механизм действия. Различия в стране происхождения.

    • «Воск ДТ». Французская фармацевтическая компания.
    • «Imovaks D.T. Adulte». Французское производство.

    Конечно, выбор будет зависеть от наличия или отсутствия того или иного препарата в медицинском учреждении. Вы можете самостоятельно приобрести желаемую вакцину, но, как показывают отзывы, российский продукт ничем не хуже импортных аналогов.


    При записи ребенка в детский сад, школу или детский летний лагерь врачи постоянно проверяют наличие всех прививок.Даже у взрослых вакцинация проверяется при работе на предприятиях общественного питания, в медицинских учреждениях и т. Д. Вакцинация ADSM - одна из важнейших прививок для человека, которую делают не только в детстве, но и на протяжении всей жизни.

    Вакцина защищает от двух самых опасных болезней, встречающихся повсюду - столбняка и дифтерии. По данным ВОЗ, с введением повсеместной вакцинации против столбняка количество смертей от этой болезни снизилось на 94%.Не менее опасна дифтерия: 10% случаев заболевания заканчиваются смертью больного человека.

    ADSM - это сокращение от: адсорбированная вакцина против дифтерии и столбняка в малых дозах. Создается препарат на основе анатоксинов, исключающий возможность побочных реакций. Действие вакцины основано на иммунологической реакции организма. ADSM отличается от вакцинации АКДС отсутствием коклюшного компонента.

    АДСМ следует вводить в организм периодически на протяжении всей жизни для поддержания иммунитета к заболеваниям на необходимом уровне.Вакцинация широко применяется для ревакцинации детей старше 6 лет, ранее вакцинированных АКДС. Почему делается прививка от ADSM? Его задача - поддерживать необходимый уровень антител в крови против таких тяжелых инфекционных заболеваний, как дифтерия и столбняк. Каждая прививка продлевает иммунитет на 10 лет.

    Вакцинация ADSM является обязательной для взрослых. Без него практически невозможно избежать опасности заражения столбняком - серьезным заболеванием, от которого до сих пор не существует эффективного лечения.

    Основные преимущества ADSM

    Что это за вакцина ADSM? Вакцина ADSM - это запатентованный вариант вакцины DPT. АКДС содержит дополнительный компонент коклюша. ADSM устанавливается во время ревакцинации, чтобы продлить срок действия ранее приобретенного иммунитета.

    АДСМ назначают взрослым и детям старше 4-6 лет, для которых коклюш уже не так опасен. У малышей от 4 лет коклюш протекает в легкой форме, а до 4 лет коклюш может привести к смерти ребенка.ADSM назначают всем взрослым каждые 10 лет и детям, которые не переносят компонент коклюша.

    Вакцина содержит активные ингредиенты, которые действуют против двух инфекций, поэтому ее называют бивалентной. Он содержит половину дозы анатоксина столбняка и дифтерии. Этой половины дозы вполне достаточно, чтобы реактивировать ранее приобретенный и время от времени ослабленный иммунитет. Помимо бивалентной вакцины ADSM, существуют также 2 моновалентные вакцины:

    • АС - против столбняка;
    • г. н.э. - против дифтерии.

    Это моновалентные вакцины, каждая из которых содержит только один активный ингредиент.

    Давайте посмотрим, почему поливалентные вакцины предпочтительнее моновалентных:

    1. При создании поливалентной вакцины проводится дополнительная очистка биологических компонентов, а это означает, что поливалентные вакцины очищаются лучше, чем моновалентные. Это означает, что они вызывают намного меньше побочных реакций.
    2. Ребенку и даже взрослому намного легче вынести одну инъекцию, чем две и более.
    3. При введении любой вакцины в организм попадает определенное количество консервантов и других балластных веществ, которые всегда есть в вакцине. При введении одной вакцины этих балластных веществ в организм поступает меньше, чем при введении нескольких.

    В развитых странах мультивалентные вакцины занимают лидирующие позиции в последнее десятилетие. Для инокуляции используются рекомбинантные вакцины, полученные с помощью генно-инженерных технологий.Это высокая степень очистки, низкая реактогенность и возможность за один раз сделать прививку пациенту от нескольких инфекций.

    График вакцинации ADSM

    Время вакцинации зависит от ADS, когда была сделана DPT. Если ребенок был своевременно вакцинирован АКДС, то по графику прививок выдается АДСМ:

    • в возрасте 4 или 6 лет, когда сделана вторая ревакцинация r2 ADSM;
    • соответственно, в 14 или 16 лет проводится третья ревакцинация r3 ADSM.Срок устанавливается ровно через 10 лет после второй ревакцинации.

    Если ребенок не переносит первый DPT, его заменяют на ADSM. Именно коклюшный компонент АКДС чаще всего вызывает побочные и аллергические реакции. В этом случае вводится вакцина:

    • на 3 месяца;
    • в 4,5 месяца;
    • в 6 месяцев;
    • в 1,5 года вводится дополнительная бустерная доза вакцины, усиливающая иммунологический эффект.

    Первые 3 прививки необходимы для формирования полноценного иммунитета, поэтому содержат большое количество вакцины. Все прививки после первых четырех называются ревакцинациями. Поскольку иммунная система сформирована, они содержат уменьшенную дозу активного ингредиента. Ревакцинация АДСМ детям произведена:

    • в возрасте 6 лет;
    • в 16 лет (через 10 лет).

    После этого взрослого человека следует вакцинировать каждые 10 лет, ведь именно столько времени действует сформированный иммунитет.Прививки ADSM делаются взрослым в возрасте 24–26 лет, затем в возрасте 34–36 лет, затем в возрасте 44–46 лет, в возрасте 54–56 лет и старше. Для вакцинации ADSM не существует верхнего возрастного предела, так как любая возрастная группа восприимчива к этим инфекциям.

    Если взрослый никогда не был вакцинирован ADSM, то ему придется сделать 3 прививки. ADSM выполняется по схеме - 0-1-6:

    • первая вакцинация;
    • через месяц вторая вакцинация;
    • через полгода - третья вакцинация.

    Следующая ревакцинация через 10 лет.

    Если взрослый пропустил ревакцинацию, но помнит об этом до истечения 20-летнего срока, то ему вводят одну дозу вакцины. Если с момента последней вакцинации прошло более двух лет, то вводят 2 дозы вакцины ADSM с интервалом в месяц.

    Если взрослый пропускает ревакцинацию, уровень его антител снизится, и они не смогут защитить организм от болезней.Если человек, пропустивший ревакцинацию, заболеет столбняком или дифтерией, то если он ранее был вакцинирован АДСМ, то в любом случае он перенес эти заболевания намного легче, чем полностью невакцинированный.

    Также можно отметить, что болезнь сама по себе не создает иммунитета в организме. Следовательно, человек, который однажды переболел дифтерией или столбняком, всегда может заразиться второй раз.

    Кроме того, вакцинация ADSM дополнительно назначается, если непривитый человек контактировал с больным дифтерией с целью формирования экстренного иммунитета.

    Состав вакцины и ее аналогов

    Одна доза вакцины ADS N содержит:

    • 5 единиц анатоксина против дифтерии;
    • 5 единиц столбнячного анатоксина;
    • дополнительные компоненты: гидроксид алюминия, тиомерсал, формальдегид и др.

    В карточке при ревакцинации можно увидеть обозначение: вакцинация r2 ADSM. Это означает, что проводится вторая ревакцинация. Если обозначение - вакцинация r3 ADSM, это означает третью ревакцинацию.Соответственно, после третьей ревакцинации rv3 последует четвертая rv4 и так далее.

    Чаще всего иммунизация детей, подростков и взрослых проводится отечественным препаратом АДСМ, который не поступает в свободную продажу, а распространяется и исключен в поликлиниках. Эти прививки ADSM абсолютно бесплатны.

    Тем, кто особенно недоверчиво относится к отечественным вакцинам, в крупных аптеках в свободном доступе предлагается импортный аналог вакцины из Франции - Имовакс DT Adyult.Существуют также ранее упомянутые отдельные формы столбнячного и дифтерийного анатоксинов - АС и АД.

    Где можно получить вакцину ADSM?

    Где взрослые и дети проходят вакцинацию ADSM? Во время вакцинации высвобождение активного препарата происходит постепенно. Только так формируется полноценный иммунный ответ. Если вся доза попадет в кровоток, то она будет разрушена иммунокомпетентными клетками, не успев сформировать иммунитет.

    Следовательно, АДСМ вводят только внутримышечно.В мышце активный компонент образует депо, из которого он с низкой скоростью выделяется в кровь. Детям обычно следует вводить инъекции в бедро (снаружи), в плечо (в дельтовидную мышцу) или под лопатку. Вакцинация ADSM для взрослых проводится подкожно под лопатку. АДСМ не вводят в ягодицу, так как инъекция может повредить седалищный нерв.

    Где получить вакцину ADSM

    Обычно такая плановая вакцинация проводится в поликлинике по месту жительства.Вы можете сделать прививку ADSM в поликлинике по месту работы. Сначала необходимо посетить терапевта, который выяснит, есть ли противопоказания к вакцинации, и ознакомится с часами работы палаты вакцинации. Помимо поликлиники, вы можете обратиться в специализированный центр вакцинации для вакцинации ADSM.

    Эту услугу также предоставляют частные клиники. Обычно они предлагают выбор между отечественными и зарубежными вакцинами. Некоторые клиники даже предлагают посещения на дому.

    Основные противопоказания

    Как и любые другие вакцины, у АДСМ есть противопоказания.Невозможно вакцинировать:

    • беременных;
    • при обострении хронических заболеваний;
    • в острой фазе любого заболевания;
    • при наличии индивидуальной чувствительности;
    • при текущих аллергических заболеваниях.

    Прививка ADSM и беременность

    Во время беременности АДСМ не вакцинируют. Если беременность запланирована, то после вакцинации нужно подождать 30 дней и только потом начинать зачатие. Если вакцинация была проведена, и после нее женщина узнала о текущей беременности, то в прерывании беременности нет необходимости.Вакцина не вредна для плода.

    Правила поведения до и после вакцинации

    Вакцинация не требует специальной подготовки. Примерно за неделю до плановой вакцинации нужно следить за своим самочувствием или самочувствием ребенка, избегать переохлаждений и сквозняков, чтобы не заболеть. Если вы чувствуете себя хорошо, можете сделать прививку.

    После вакцинации ADS лучше пить больше жидкости и на пару дней отказаться от алкоголя.Запретов на купание и прогулки нет. Как правило, побочные реакции на вакцину возникают очень редко.

    1. Температура может повыситься. Чаще до 37 градусов, иногда до 39. Высокую температуру можно сбить жаропонижающими препаратами. Это нормальная реакция организма, которая пройдет в течение нескольких дней.
    2. Если на месте образовалась шишка, нужно запастись терпением - она ​​рассосется сама по себе за одну-две недели. Это место нельзя отапливать. Если болит шишка, можно принимать обезболивающие - анальгин, ибупрофен.
    3. Также может появиться ухудшение аппетита, тошнота, нарушение стула, раздражительность - все эти реакции обычно развиваются в первые сутки после вакцинации. Если они появились позже, то, как правило, никакого отношения к вакцинации не имеют.

    Отказ от вакцинации

    И вакцинируемый взрослый, и родители вакцинируемого ребенка могут отказаться от вакцинации по личным причинам. Отказ может быть сделан у педиатра или у терапевта.Как правило, у взрослого человека потребность в вакцинации возникает при трудоустройстве. Существует определенный перечень работ, выполнение которых требует обязательной вакцинации. Вы можете увидеть этот список в Постановлении Правительства № 825 от 1999 года. При отсутствии профилактической вакцинации работодатель из этого списка может отказать в приеме на работу потенциальному соискателю.

    Кроме того, непривитый гражданин:

    • не сможет выезжать за границу в некоторые страны, посещение которых требует профилактических прививок;
    • может получить временный отказ в приеме в образовательные учреждения в случае массовых заболеваний.

    Здравствуйте дорогие папы и мамы! Вокруг прививок, включая ADSM, всегда были споры. Одни называли их панацеей от серьезных болезней, другие - необоснованным риском для здоровья ребенка. Ну, как бы то ни было, их делали раньше и продолжают делать сейчас. Правда, иногда неохотно и даже с опаской. Именно поэтому мы решили помочь молодым родителям разобраться хотя бы с одной из них и рассказать о том, что такое вакцина от ADS, что это такое, какие противопоказания и побочные эффекты у нее есть.

    И, наконец, стоит ли отказываться от этого. Ведь она обещает предотвратить такие серьезные недуги, как дифтерия и столбняк. Первый передается воздушно-капельным путем, а второй - контактным. Но для обоих характерна печальная статистика - смерть у детей наступает в 20-40% случаев из 100%. И оба имеют ужасные последствия.

    Расшифровка вакцины ADSM говорит о том, что это дифтерийно-столбнячный анатоксин в малых дозах.

    Отсюда его второе название, вернее - ADS-m.В отличие от более распространенной АКДС, в отсутствии коклюша, она занимает свое место в календаре иммунизации.

    Кстати, из-за содержания в нем биологического материала в гораздо меньших дозах по сравнению с той же АКДС, АДСМ применяют только для ревакцинации. Однако и в этом есть свои преимущества. Его легче переносят дети, у которых была бурная реакция на вакцину АКДС.

    Многие родители боятся вакцин, потому что считают их лекарствами с полуживыми возбудителями этих очень опасных болезней.На самом деле это не так.

    Вакцины содержат анатоксины. Это токсины, которые вырабатываются этими патогенами, но затем обрабатываются в лабораторных условиях таким образом, что их негативное воздействие на организм полностью сводится к нулю, но они сами могут заставить его выработать необходимые антитела и, следовательно, иммунитет.

    2. Типы прививок


    Вакцина ADSM, имеющаяся на рынке сегодня, имеет свои собственные разновидности.

    Бывает:

    • отечественный - дешевле, но экономия не всегда оправдана.Считается, что такая вакцина может спровоцировать развитие побочных эффектов в виде повышения температуры тела и боли в области укола.
    • иностранный Имовакс Д. Т. Взрослый - он дороже и легче переносится организмом.
    • моновалентная - отдельная вакцина от дифтерии под названием AD и столбняка - AS.

    Однако врачи говорят, что можно свести к минимуму эффекты любого типа вакцины ADSM. Как? Просто придерживайтесь правил относительно сроков вакцинации и подготовки к ней.

    3. При вакцинации ADSM

    Время введения вакцины ADSM зависит от вакцинации АКДС.

    Если когда-то это было сделано вовремя, врачи соблюдают национальный график вакцинации и назначают инъекции:

    • в 6 лет (или в 4 года), когда делается r2 ADSM, или вторая ревакцинация .
    • в 16 лет (или в 14 лет), когда делается r3 ADSM, или третья ревакцинация. Очень важно, чтобы между двумя инъекциями прошло ровно 10 лет.

    Есть еще одна схема. Применяется, , когда ребенок не переносит вакцину АКДС ... По ее словам, вакцину АДСМ вводят:

    • 3 мес;
    • 4,5 месяца;
    • 6 месяцев;
    • 1,5 года;
    • 6 лет;
    • 16 лет.

    После этого нужно каждые 10 лет делать прививки, так как именно на столько действует сформированный иммунитет.

    Кроме того, вакцина ADSM может быть назначена, если непривитый ребенок контактировал с пациентом с дифтерией, чтобы сформировать экстренный иммунитет.

    4. В случае вакцинации ADSM

    Традиционно ADSM вводят внутримышечно. Наиболее частым местом инъекции является бедро, плечо или область под лопаткой.

    Выбор оптимального зависит от возраста и строения человеческого тела. Детям с неразвитой мышечной массой вводят в бедро, так как в этом месте мышцы вплотную подходят к коже. И они считаются более развитыми, чем остальные.

    При наличии хорошо развитого мускульного каркаса предпочтение отдается плечу.

    Под лопаткой ADSM вводится в случае существующего подкожно-жирового слоя, который блокирует доступ к мышцам в других областях.

    Почему АДСМ проводят внутримышечно? Потому что в этом случае лекарство будет поступать в кровоток постепенно, провоцируя желаемый ответ иммунной системы. Если он полностью и немедленно попадет в кровоток, иммунная система немедленно отреагирует и просто уничтожит его. А вместе с тем надежда на формирование иммунитета организма к инфекциям и защиту от них.

    5. Введение вакцины ADSM: чего ожидать

    Могут ли возникнуть отрицательные реакции на вакцину? да. Как правило, они появляются в первые три дня после укола и, по заверениям врачей, никак не влияют на будущее здоровье ребенка. И они проходят бесследно.

    К ним относятся:

    • температура - она ​​может быть незначительной и подниматься до 37 С или довольно высокой - до 39 С, когда ребенку нужны жаропонижающие.Но в любом случае это означает только одно: иммунная система работает!
    • местная реакция - от легкого покраснения до уплотнения, припухлости или бугорков, не требующих дополнительного ухода, но проходящих самостоятельно;
    • понос и рвота;
    • потеря аппетита;
    • капризность, беспокойство, заторможенность реакций;
    • нарушение подвижности конечностей из-за появления сильной боли в области укола. В первые 2-3 дня можно бороться самостоятельно, давая обезболивающие и прикладывая лед к месту локализации боли.

    В дальнейшем без консультации врача не обойтись.

    Осложнения после ADS у детей очень редки. Если быть точным, то в 2 случаях из 100 тысяч.

    Они могут проявляться в форме:

    • аллергическая сыпь, ангионевротический отек, анафилактический шок и другие тяжелые аллергические реакции;
    • энцефалит;
    • менингит.

    Но бояться их не стоит, поскольку подобные явления - не более чем результат несоблюдения противопоказаний к вакцине ADSM.

    6. Противопоказания к ADSM


    Как и другие лекарства, вакцина ADSM имеет свои противопоказания. Их не так уж и много, однако обязательно обращать на них внимание, что и делают педиатры, когда перед вакцинацией проводят небольшой опрос матери.

    1. индивидуальная непереносимость компонентов;
    2. наличие всех болезней;
    3. обострение хронических недугов;
    4. иммунодефицит;
    5. чрезмерно бурная реакция на ранее вакцинированный ADSM.

    7. Подготовка и введение вакцины ADSM

    Знаете ли вы, что можно свести к минимуму возникновение всех видов негативных последствий введения вакцины ADSM?

    Все, что для этого нужно, - это прислушаться к советам педиатров и правильно подготовиться к вакцинации:

    1. Избегайте людных мест, посещений и путешествий за несколько дней до процедуры;
    2. воздерживаться от введения новых продуктов в рацион ребенка;
    3. принимать противоаллергические препараты за пару дней до вакцинации и после нее.

    Сразу после укола при появлении аллергической реакции лучше остаться в поликлинике на 30-40 минут. Кстати, на вопрос "Можно ли мочить место вакцинации ADSM?" все врачи отвечают утвердительно.

    8. Отзывы о вакцине

    Анастасия:

    Мы сделали АДСМ, когда нам было 6 лет, и даже не заметили этого. Ребенок чувствовал себя прекрасно. Говорят, это связано с отсутствием в его составе коклюша.

    Лена:

    Эту вакцину моей дочери сделали в поликлинике. Реакции не было, но по совету врача дала Фенистил за 3 дня до и еще через 3 дня (от аллергии). Думаю, благодаря ему все хорошо. Хотя многие говорят, что само по себе переносится легко.

    Ксюша:

    Пару дней назад у моей дочери (6 лет) был АДСМ. Позавчера у нее заболела нога в области укола, и к утру она не смогла наступить на нее.Прописали антигистаминный препарат, надеюсь поможет.

    Инна:

    У нас на АДСМ поднялась температура и болела в ноге, не зря он не внушал мне доверия.

    Подводя итог вышесказанному, хочу напомнить, что сколько людей - столько мнений и вакцинация ADSM не исключение. Делать это для своего ребенка или нет - решать только вам.

    Главное взвесить все за и против.

    Вы можете посмотреть видео о том, как подготовиться к вакцинации здесь:

    А здесь вы найдете информацию о том, когда вакцинацию делать нельзя:

    Из этого видео вы узнаете о возможных осложнениях и реакциях на вакцинацию:

    Поделитесь этой информацией с друзьями об этой статье.И обязательно посетите нас снова. А чтобы ничего не пропустить, подписывайтесь на наши обновления. Мы ждем вас! И желаем только правильных решений и легких прививок!

    Прививки АДС-М можно использовать для вакцинации детей и взрослых. ADCM означает адсорбированный дифтерийно-столбнячный препарат в малых дозах. Взрослым дают чаще, чем детям, так как небольшие дозы препарата нужны только для ревакцинации. Вакцина формирует у человека иммунитет против дифтерии и столбняка.

    Вакцина ADSM похожа на хорошо известную вакцину АКДС. Разница в том, что АКДС, помимо дифтерии и столбняка, защитит малыша от коклюша. Когда применение АКДС невозможно или нерационально, специалисты прибегают к вакцине ADCM.

    Состав вакцины

    Вакцинация ADSM является бивалентной, поскольку ее действие направлено против возбудителей двух разных заболеваний. В состав препарата для вакцинации входит 10 единиц дифтерийного и 10 единиц столбнячного анатоксина в 1 мл.Анатоксин - это препарат из токсина патогена, не обладающий токсическими свойствами, но способный вызывать образование антител к этому патогену.

    Существуют моновалентные вакцины против дифтерии и столбняка, которые также используются для создания иммунитета, но использование двухвалентных вакцин более рационально, так как к их изготовлению предъявляются более жесткие требования: требуется максимальная чистота каждого используемого компонента. Еще одно важное преимущество - меньшее количество предстоящих инъекций, вызывающих страх у младенцев.

    В детском возрасте вакцина АДСМ, как правило, не вводится. До достижения ребенком 6-летнего возраста применяется АКДС, в состав которой входит противококлюшный компонент. Но не следует исключать такую ​​ситуацию, когда она вызывает у ребенка побочные реакции. Затем специалисты решают ввести ребенку вакцину ADS. Он отличается от ADSM тем, что содержит большие дозы токсоидов.

    Если ребенку, не достигшему шестилетнего возраста, сделать прививку АДСМ, то это приведет к сбою иммунитета против этих заболеваний, так как в этом возрасте организм ребенка только начинает знакомиться с прививками, поэтому , дозы должны быть высокими.

    Редко, но бывает, когда даже на прививку ADS, где нет противококлюшного компонента, вызывающего большинство побочных реакций, организм ребенка очень бурно реагирует: поднимается высокая температура, образуется отек и место укола становится уплотненный. В таких условиях ребенку необходимы небольшие дозы анатоксина. Решением в этой ситуации является использование ADSM.

    Детям делают прививки в три, четыре с половиной и шесть месяцев. В полтора года ребенку делают бустерную вакцинацию, цель которой - поддержание иммунитета.Все последующие инъекции препарата будут называться ревакцинацией - r ADSM.

    Ревакцинацию детям проводят в возрасте 4-6 лет, затем в возрасте 14-16 лет, затем каждые 10 лет в течение всей жизни. Раньше последняя ревакцинация проводилась в возрасте 64-66 лет, но теперь ее можно проводить в более старшем возрасте в экстренных случаях или по желанию пациента.

    Особенности введения вакцины

    Вакцинация, как и любые другие медицинские манипуляции, должна проводиться в стерильных условиях с соблюдением правил асептики и антисептики.

    Перед процедурой медсестра должна проверить ампулу на соответствие названия препарата рецепту врача, целостность ампулы и срок годности.

    Инъекцию следует проводить строго внутримышечно, так как при попадании препарата в подкожно-жировую клетчатку может развиться абсцесс, а при попадании в кровоток непосредственно через артерию или вену содержимое ампулы немедленно обезвреживается иммунной системой. клетки.

    Традиционным местом введения препарата детям является передняя поверхность бедра, так как в этой области отсутствуют нервные стволы.У взрослых местом инъекции является внешняя поверхность плеча. Если в этой области большое количество подкожно-жировой клетчатки, то укол делается под лопатку.

    Показания и противопоказания

    Все люди должны быть вакцинированы против дифтерии и столбняка, независимо от возраста и в соответствии с графиком вакцинации.

    Осложнения и побочные эффекты

    В отзывах людей после процедуры можно наблюдать совершенно разные реакции на вакцину - от полного отсутствия побочных эффектов до различной степени недомогания.

    После инъекции, при попадании АДСМ внутрь организма (вакцинация взрослых) побочные эффекты могут быть разными:

    1. Слабость, головная боль, сонливость
    2. Повышение температуры до субфебрильных значений
    3. Диспептические расстройства: тошнота, рвота, диарея, потеря аппетита.

    Через некоторое время после введения вакцины ADS-M осложнения возникают довольно редко: 2 случая на 100 000 прививок. Возможны следующие состояния:

    1. Аллергические реакции (от крапивницы до анафилактического шока).
    2. Энцефалит и менингит.

    Пункты вакцинации

    Вакцинация ADSM проводится в поликлинике по месту жительства. Перед посещением больницы следует уточнить график прививочного кабинета, а также дни, когда медперсонал работает с этой вакциной.

    Помимо государственных и муниципальных учреждений здравоохранения вакцинацию можно проводить в частных медицинских центрах и организациях. В таких учреждениях у пациента есть выбор: отечественного или импортного препарата ввести .

    Пациенту необходимо подготовиться к вакцинации. Укол лучше делать натощак, поэтому нужно отказаться от еды за 12 часов до назначенного времени. Следует избегать контакта с больными людьми за несколько дней до вакцинации. Если ребенку нужно сделать прививку, то перед манипуляцией необходимо показать его педиатру ... Взрослый также должен обратиться к врачу, чтобы исключить наличие различных заболеваний.

    ADSM - это вакцина, которую мы называем неправильно.Мы пишем ADSM, но на самом деле это ADS-m, где «m» просто означает небольшую дозу приложения. Буква «A» в нем обозначает адсорбированный тип вакцины, «D» означает, что она помогает против дифтерии, а «C» - что она также может помочь против столбняка.

    Заявка

    По своей сути эта вакцина является своеобразной альтернативой АКДС, только в АКДС добавлена ​​буква «К», то есть она также помогает от коклюша. Это очень важно, потому что болезнь по своей сути очень опасна, но только АКДС дает довольно частые осложнения в период после вакцинации.При всех преимуществах АКДС, он может просто не приниматься организмом, и может возникнуть негативная реакция. Затем DPT заменяется ADSM, который, хотя и не помогает победить коклюш, более мягкий и поэтому больше подходит для многих младенцев, которые слишком остро реагируют на коклюшный препарат. Однако решение о том, какую из прививок следует сделать, должен принимать лечащий врач. Подробнее о вакцинации:

    Когда она проводится?

    Эту вакцинацию необходимо проводить в достаточное время, чтобы сформировать иммунитет, который не подействует в будущем.Поэтому проводится первичная вакцинация, а затем несколько последующих ревакцинаций через:

    • 3 месяца;
    • 4,5 месяца;
    • 6 мес.

    Фиксирующая вакцинация проводится через полтора года, после чего можно повторить процедуру еще раз, но только теперь в шестилетнем возрасте.

    Важно понимать, что каждая последующая вакцинация ADSM или DPT может вызывать все более бурную реакцию в организме, что является нормальным явлением.Это очень хорошо, значит, иммунная система ребенка работает как надо, что если болезнь вдруг все-таки возникнет, он готов с ней бороться в необходимой степени.

    Однако эта вакцинация делается не только детям, хотя основной упор делается на них. Это можно сделать позже, в подростковом возрасте. Первую вакцинацию делают подростки в возрасте 14-16 лет, а затем циклически все повторяют примерно каждые 10 лет. Например:

    Считается, что именно в течение десяти лет человеческий организм является наиболее защищенным, именно тогда защитные силы, которые приносит вакцинация, активируются в максимальной степени.Но на самом деле, даже если не повторить вакцинацию через десять лет, то все равно защита организма будет намного лучше, чем когда вакцина не сделана в принципе, поэтому игнорировать ее нельзя. Нельзя игнорировать это даже в преклонном возрасте, потому что тогда организм человека еще больше ослабляется, а потому шансы заболеть просто значительно возрастают, поэтому вакцинация необходима.

    Варианты

    Эта вакцина отсутствует только в одном варианте, есть несколько различных аналогов, которые вы можете выбрать, если хотите провести качественную вакцинацию:

    1. Отечественный вариант ADSM.Самый простой, наименее дорогой, а потому так часто используемый.
    2. Импорт, под маркой Имовакс ДТ Адюльт. Это примерно то же самое с точки зрения положительных эффектов, но с точки зрения побочных реакций намного безопаснее, шансы, что это вызовет что-то отрицательное, намного меньше.
    3. Моновалентные вакцины. Вы можете сделать прививку от столбняка отдельно, и, кроме дифтерии, результат будет практически таким же.

    В таких случаях лучше всего подходит импортная вакцина, но она намного дороже по сравнению с АДСМ и АКДС, поэтому часто к ней предпочитают не прибегать, выбирая более дешевые, но все же эффективные варианты.

    Реакция на вакцинацию

    Иногда вакцинация ADSM или DPT вызывает определенную реакцию, например, повышение температуры тела, капризность ребенка. беспокойство, диарея, проблемы с аппетитом, отек в месте укола. Все это нормальные реакции, которые со временем постепенно проходят.

    Если есть какая-то более специфическая реакция, которая не отступает и доставляет дискомфорт, то лучше обратиться к врачу для принятия определенных мер.

    Заключение

    ADSM и ACSD - важные прививки, которые необходимо делать, чтобы спровоцировать проблемы со здоровьем.Но при этом необходимо понимать, что это именно, для чего они сделаны, в чем разница между ними и как часто их нужно повторять, повторные ревакцинации. Тогда шансов сохранить здоровье и вас, и вашего ребенка будет намного больше.

    Применение вакцины АДСМ в соответствии с установленными врачебными инструкциями.
    Уплотнение после вакцинации АКДС
    Место укола покраснело после прививки АКДС - что делать? Импортная вакцина АКДС, преимущества, недостатки, стоимость Ревакцинация АКДС: сроки и возможные последствия после вакцинации

    .

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *

    Copyright © 2019 Sozvezdie