Рубрика

Гиперплазия плаценты при беременности что это: врач-патологоанатом об уникальном органе — MAMA PRO

Содержание

Гиперплазия плаценты | Деткино


Вопрос акушерке:

Вилена Александровна, очень прошу вас рассказать про гиперплазию плаценты. Чем это опасно и что необходимо принимать, для нормального развития ребенка? Мне 24 года, срок беременности в данный момент 21 неделя, беременность первая. В 19 недель была на втором УЗИ, поставили диагноз гиперплазия плаценты, толщина 29 мм, степень зрелости-1. Врач, который меня наблюдает, сказала, что это последствия уреаплазмы и микоплазмы. Лечение от уреплазмы я прошла в 16-17 недель. У меня 3-я группа крови с отрицательным резусом, сдавала 2 раза анализ на антитела, сказали, что их нет. Врач назначила принимать куралтин 25 мг 1т*3р в течении 3-х недель, магний В6 2т*2р в течении 2-х недель и омега 3 1т*1р в течении месяца, очень переживаю за развитие ребенка, врач сказала, что старение плаценты не остановить и результат беременности неизвестен… (Юлия)
Ответ:
Уважаемая Юлия! Гиперплазия плаценты является отклонением, которое может быть следствием

  • резус-конфликта, при отрицательном резус факторе крови,
  • при тяжелом течении анемии, во время которой снижается количество гемоглобина,
  • при сахарном диабете,
  • при сифилисе, а так же других инфекционных заболеваний плаценты в период беременности, таких как токсоплазмоз и микоплазмоз, уреаплазмоз, хламидиоз.
  • всевозможные инфекционные заболевания, которые переносит женщина в период беременности, значительно влияют на состояние плаценты и околоплодных вод.

Конечно же, необходимо вовремя лечить гиперплазию, т.к. плацента это самый важный орган при беременности, который питает ребеночка питательными веществами, а если нарушается работа плаценты то страдает и плод, не лечение может привести к задержке внутриутробного развития плода, также к гиперплазии может присоединиться и гемодинамические нарушения (ГДН), маловодие или многоводие, гиперплазия плаценты может привести к преждевременным родам.

Но переживать не стоит, потому-что, при назначении адекватного лечения плацента приходит в норму. Обязательно делайте лечение которое вам назначил доктор. Из препаратов обычно назначают курантил, актовегин, эссенциале форте. Ну и конечно же, необходимо лечить первоочередную причину, которая вызвала гиперплазию плаценты, в вашем случае скорее всего это была инфекция. Удачи!

С уважением, акушерка
Кузнецова Вилена Александровна

Ответ консультанта опубликован 01.03.2012


Гиперплазия плаценты при беременности: как и чем лечить

Гиперплазия плаценты при беременности – это диагноз, который указывает на утолщение эмбрионального органа и возможное возникновение осложнений.

Детское место окончательно формируется к началу второго триместра и до 36-37 недели только продолжает развитие и рост совместно с плодом. При ультразвуковом исследовании измеряют толщину оболочки, как правило, около пуповины, и сравнивают с показателями нормы. Гиперплазия плаценты при беременности определяется в случае явного утолщения, что говорит о снижении функциональности органа.

Условные нормы созревания

Формирование временного эмбрионального органа в период вынашивания очень важно, т.к. от него зависит жизнеспособность ребенка. Кислород, питательные вещества и защитные функции доставляет по кровеносным сосудам именно плацента, которая в процессе родовой деятельности прекратит свое существование.
 
Существует 4 условные стадии развития, каждой из которых соответствует определенный показатель:
  1. 0 степень созревания длится до 30 недели и характеризуется интенсивным ростом, вплоть до 30,5 мм.
  2. 1 степень определяется с 27 по 36 неделю и обуславливается параметрами от 27,8 мм до 35,6 мм.
  3. 2 степень подразумевает формирование временного органа с 34 по 39 недели, с показателями, которые могут колебаться в пределах 34-35 мм.
  4. 3 степень определяется после 36 недели, а толщина может достигать 34 мм. Наблюдается период старения с подготовкой к родовой деятельности.
Гиперплазия плаценты при беременности предполагает значительное превышение нормальных показателей толщины. При диагностировании специалисты учитывают также и индивидуальные особенности женского организма, ее телосложение.

Ультразвуковое исследование не является единственным аргументом для постановки диагноза и назначения лечения. Применяются дополнительные обследования для того, чтобы определить гиперэхогенные включения в плаценте при беременности. Этот показатель указывает на повышенное содержание кальцинатов, что в свою очередь говорит о преждевременном старении оболочки и наличии гипоксии у плода.

Причины гиперплазии у беременных

Основной причиной формирования гиперплазии считаются инфекционные заболевания. Вредоносные бактерии проникают в полость матки восходящим путем, таким образом, воспаляется детское место и одновременно с утолщением возникает плацентит. Заболевание, которое опасно для жизнедеятельности младенца.
 
Другими, не менее важными факторами риска являются:
  • конфликт резус-фактора матери и младенца;
  • гестоз, который приводит к отечным реакциям;
  • анемия приводит к кислородному голоданию ребенка;
  • аномальные проявления, связанные с наследственностью.
Не редко, гиперплазия при беременности, сопровождается многоводием или, наоборот, маловодием.
 

Чем опасна гиперплазия для беременности

На ранних сроках патологию невозможно определить. Только после первого УЗИ, специалист способен предоставить предварительные параметры толщины.
 
Во втором триместре, когда чувствуется движение плода в утробе, по характеру шевелений, слишком быстро или медленно, можно заподозрить патологию. Сердцебиение младенца имеет характерные черты тахикардии или брадикардии. Резкие скачки сердцебиения у младенца обуславливаются кислородным голоданием. Поэтому после ультразвукового исследования требуется пройти обследование при помощи кардиотокографа.
 
Утолщение оболочки приводит к преждевременному старению органа, ребенок недополучает питание, защита эмбриональной оболочки снижается. Возникает угроза задержки внутриутробного развития, преждевременных родов и самопроизвольного выкидыша.

Чем лечить гиперплазию плаценты при беременности?

Если наблюдается незначительные признаки, то часто врачи принимают решение о наблюдении за пациенткой. Лечение в таком случае не понадобится, только строгий контроль над функционированием детского места.

После подтверждения диагноза, специалистами назначается курс лечения общей направленности:

  • улучшение кровообращения;
  • препараты для разжижения крови;
  • средства для повышения уровня гемоглобина;
  • активизация обмена веществ;
  • витаминный комплекс с обязательным содержанием фолиевой кислоты.
Если гиперплазия возникла по причине заражения инфекцией, то, прежде всего, лечить начинают первоисточник патологии – назначаются антибактериальные и противовирусные средства.

При конфликте резус-факторов матери и ребенка рекомендуется прерывание вынашивания плода, так как ситуация связана с большими рисками для жизни. Часто применяют переливание крови для нормального внутриутробного развития плода.

Гиперплазия плаценты — причины, симптомы, диагностика и лечение

Гиперплазия плаценты — увеличение толщины и объема плацентарной ткани, связанное с действием компенсаторных и патологических факторов. Специфические клинические симптомы отсутствуют. На поздних этапах при наличии плацентарной недостаточности патология проявляется изменением активности плода — усилением или замедлением его шевелений. Для постановки диагноза используют УЗИ матки, КТГ, допплерографию плацентарного кровотока, инвазивные пренатальные методы исследований, лабораторные анализы. Лечение направлено на улучшение кровотока в маточно-плацентарной системе, устранение причины расстройства и коррекцию сопутствующих нарушений.

Общие сведения

В современном акушерстве утолщение плаценты рассматривается не как отдельная нозологическая единица, а как важный диагностический признак, свидетельствующий о наличии другой патологии. В норме по мере развития беременности плацентарная ткань постепенно утолщается, достигая максимальных размеров к 34-36 неделе. После этого ее рост останавливается, а объем остается таким же или даже несколько уменьшается. При гиперплазии плаценты ее масса достигает 750 г и более вместо средних 400-600 г, а плодово-плацентарный коэффициент, отражающий соотношение веса ребенка и плацентарной ткани, к концу беременности составляет не более 2-3 вместо нормальных 6-7.

Гиперплазия плаценты

Причины гиперплазии плаценты

Утолщение плацентарной ткани обычно является следствием компенсаторных реакций и защитных механизмов, призванных обеспечить оптимальные условия развития и безопасность плода. В ряде случаев увеличение массы плаценты вызвано патологическими изменениями в ее тканях. По мнению специалистов в сфере акушерства и гинекологии, основными причинами гиперплазии органа являются:

  • Гемолитическая болезнь плода. Увеличенная плацента — один из признаков, по которым можно заподозрить изосерологическую несовместимость крови ребенка и матери. При иммунном конфликте по Rh-фактору и группе крови истинная гиперплазия плацентарной ткани с ангиоматозом ее ворсин способствует достаточной оксигенации плода.
  • Выраженная анемия матери
    . При снижении уровня гемоглобина до 70-80 и менее г/л включаются компенсаторные механизмы, направленные на улучшение кровоснабжения тканей плода. Объем плацентарной ткани увеличивается преимущественно за счет разрастания сосудов в хорионических ворсинах, что позволяет усилить кровоток и улучшить поступление кислорода к ребенку.
  • Тяжелый диабет матери. Особенностью сахарного диабета I типа и гестационного диабета является ухудшение микроциркуляции в различных органах и тканях, в том числе плаценте. Компенсаторный ангиоматоз хориональных ворсин, приводящий к гиперплазии детского места, дает возможность улучшить кровоснабжение в фетоплацентарной системе, обеспечить плод кислородом и питательными веществами.
  • Гестозы. Патологический спазм сосудов, составляющий основу таких осложнений беременности, нарушает микроциркуляцию, способствует повышению сосудистой проницаемости и накоплению жидкости в интерстициальной ткани. Аналогичные процессы происходят в плаценте – хорионические ворсины отекают, что приводит к ложной гиперплазии органа.
  • Врожденные пороки развития. Гиперплазированная плацента обеспечивает нормальную оксигенацию тканей ребенка с застойными пороками сердца, кистозно-аденоматозным пороком легких, врожденной тератомой, нейробластомой, лейкемией. Такие дефекты возникают при генетических аномалиях, внутриутробном заражении краснухой, цитомегаловирусом, парвовирусом B19, токсоплазмозом.
  • Хронические эндометриты. Воспалительные процессы в эндометрии, вызванные возбудителями гонореи, сифилиса, хламидиоза, микоплазмоза и других ЗППП, могут нарушить нормальное формирование плаценты. Увеличение количества сосудов в ворсинах, сопровождающееся истинной гиперплазией тканей, является компенсацией первичной плацентарной недостаточности.
  • Острые инфекционные заболевания матери. Разрастание плаценты у беременных, перенесших грипп, ОРВИ, другие инфекционные болезни, носит преимущественно защитный характер. В таких случаях увеличение плаценты направлено на усиление иммунного эффекта. Кроме того, компенсаторный ангиоматоз предотвращает возможные нарушения микроциркуляции.
  • Многоплодная беременность. Для адекватного развития в матке двух и более плодов требуется большее количество плацентарной ткани. Истинная компенсаторная гиперплазия детского места в случае вынашивания близнецов позволяет поставлять развивающимся плодам достаточное количество кислорода и питательных веществ. При недоразвитии плаценты возможна гибель одного из детей.
  • Заболевания плаценты. Масса плаценты возрастает при наличии в ее структуре объемных образований — первичных опухолей (хориоангиом, хорионтератом) и гнойных абсцессов. Хотя неоплазии плаценты обычно имеют небольшие размеры, их диаметр иногда достигает 5 см и более. Детское место также утолщается при воспалении плодных оболочек (хориоамнионите).

Патогенез

Механизм гиперплазии плаценты напрямую зависит от причин, спровоцировавших утолщение детского места. При истинном разрастании плацентарной ткани в основе патогенеза лежит компенсаторный ангиоматоз, возникший в ответ на кислородное голодание плода. Для улучшения фетоплацентарного кровоснабжения количество сосудов в ворсине хориона увеличивается с 4-6 до 25-50 и более, из-за чего плацента становится толще. При ложной гиперплазии размер и толщина детского места изменяются вследствие патофизиологических процессов, характерных для основного заболевания. Обычно в этих случаях объем органа увеличивается за счет отека интерстиция, реже — фиброзных и деструктивных изменений. При некоторых состояниях включаются оба механизма — компенсаторный и патологический.

Симптомы гиперплазии плаценты

На ранних этапах заболевания какие-либо клинические проявления отсутствуют, утолщение органа часто становится случайной находкой при проведении планового УЗИ после 20-й недели беременности. По мере прогрессирования гиперплазии могут возникнуть признаки, характерные для плацентарной недостаточности, — плод становится более активным, что проявляется усилением и учащением его шевелений. Прогностически неблагоприятным симптомом, при появлении которого требуется срочная консультация акушера-гинеколога, является затихание движений ребенка. Значительное увеличение живота отмечается только при сочетании гиперплазии с многоводием.

Осложнения

Последствия для плода и матери, возникающие при наличии гиперплазии плаценты, связаны с возможным нарушением ее основных функций — питательной, гормональной и защитной. При наличии патологических процессов и деструкции плацентарной ткани развивается фетоплацентарная недостаточность, влекущая за собой задержку внутриутробного развития, гипотрофию, гипоксию и в крайних случаях гибель ребенка. У беременных с увеличенной плацентой повышается риск преждевременных родов и необходимости кесарева сечения. Нарушение секреции гормонов (эстрогенов, прогестерона, хорионического гонадотропина, плацентарного лактогенного гормона, релаксина) чревато слабостью родовой деятельности, повышенным родовым травматизмом, гипотоническими кровотечениями в послеродовом периоде, гипогалактией.

Диагностика

Задачами диагностического этапа являются оценка степени гиперплазии плаценты, выявление структурных изменений и признаков функциональной недостаточности, уточнение причин, приведших к увеличению органа. Комплексное обследование включает инструментальные и лабораторные методы, позволяющие получить точные данные о состоянии плацентарной ткани, плода и беременной женщины. Для целей диагностики наиболее ценными являются:

  • Трансабдобинальное УЗИ матки. При сонографии увеличенной плаценты отмечается ее утолщение в сравнении с границами нормы для конкретного срока и расширение межворсинчатых пространств. Метод информативен, начиная с 18-20 недели гестации. УЗИ также позволяет обнаружить нарушение структуры плацентарной ткани, грубые пороки развития, признаки гипотрофии ребенка, многоводие.
  • Кардиотокография. Особое значение методика имеет для обнаружения ранних симптомов гипоксических состояний. При кислородном голодании ребенка фиксируется учащенное приглушенное сердцебиение. Последующее нарастание фетоплацентарной недостаточности сопровождается резким снижением числа сердечных сокращений плода (менее 120 ударов в минуту).
  • Допплерография маточно-плацентарного кровотока. Благодаря анализу скорости крови в сосудах плаценты можно своевременно выявить нарушения трансплацентарной динамики, вызванные гиперпластическими процессами. Метод не определяет причины возникновения патологии, но позволяет объективно оценить функционирование фетоплацентарной системы.
  • TORCH-комплекс. Комплексное серологическое исследование крови направлено на обнаружение инфекционных агентов, которые внутриутробно поражают плод. С помощью анализа подтверждают заражение токсоплазмозом, простым герпесом, краснухой, цитомегаловирусной инфекцией. В расширенном варианте методика эффективно диагностирует носительство не только перечисленных, но и других инфекций.
  • Инвазивная пренатальная диагностика. При подозрении на возникновение гиперплазии в связи с пороками развития применяют амниоскопию, амниоцентез, кордоцентез. Часть этих методов также дает возможность параллельно обнаружить признаки гипоксии и воспалительных процессов, оценить функциональное состояние и гемолитический статус ребенка при изосерологических конфликтах.
  • Выявление генитальных инфекций. Поскольку хронические воспалительные заболевания в органах малого таза способны вызвать патологические процессы в плаценте, беременным назначают ПЦР-диагностику, РИФ, ИФА (RPR и другие тесты). При наличии влагалищных выделений выполняют микроскопию и бактериологический посев с антибиотикограммой.

Для оценки функционального состояния организма женщины и выявления экстрагенитальной патологии назначают общие анализы крови и мочи, биохимическое исследование крови, определяют уровень глюкозы. В качестве вспомогательных методов обследования плода рекомендованы его фетометрия и эхокардиография. Дифференциальная диагностика проводится между заболеваниями и патологическими состояниями, провоцирующими утолщение плаценты. При необходимости пациентку консультируют эндокринолог, дерматовенеролог, инфекционист, уролог, врач-генетик.

Лечение гиперплазии плаценты

Основными целями терапии являются устранение заболевания, вызвавшего гиперпластические нарушения в плаценте, и нормализация маточно-плацентарного кровоснабжения. Кроме применения медикаментов женщине рекомендуют изменить образ жизни: увеличить время отдыха и ночного сна, полноценно питаться, избегать переохлаждений, значительных физических и эмоциональных нагрузок, дозированно выполнять специальные упражнения для беременных. При утолщенной плаценте пациентке назначают:

  • Этиологическое лечение. Выбор конкретного метода или схемы зависит от основной патологии. При выраженном резус-конфликте используют интраперитонеальную гемотрансфузию, при анемии — препараты железа с аскорбиновой кислотой, при инфекционных процессах — антибиотики, при сахарном диабете — сахароснижающие средства и т. п.
  • Препараты, нормализующие плацентарный кровоток. Чтобы улучшить перфузию, применяют актовегин , периферические вазодилататоры, антикоагулянты и антитромботические препараты, которые нормализуют микроциркуляцию крови в плаценте, ускоряют процессы утилизации глюкозы и кислорода, повышая устойчивость к гипоксии.

Дополнительно в схему лечения гиперплазии включают витаминно-минеральные комплексы, иммунокорректоры и эссенциальные фосфолипиды. Прерывание беременности выполняется только в тяжелых случаях конфликта по резус- или AB0-факторам либо при обнаружении другой патологии, представляющей непосредственную угрозу здоровью и жизни беременной или плода.

Прогноз и профилактика

Прогноз зависит от причины, вызвавшей гиперплазию плаценты, и в большинстве случаев при адекватном комплексном лечении является благоприятным. Профилактика направлена на раннюю диагностику генитальной и экстрагенитальной патологии, возможных пороков развития ребенка. Рекомендованы планирование беременности, своевременная постановка на учет в женской консультации, регулярное прохождение УЗИ-скрининга, санация очагов хронической инфекции, ограничение пребывания в местах скопления людей при эпидемиологически неблагоприятной ситуации, прием препаратов железа для предупреждения анемии.

Причины увеличения плаценты во время беременности. Что такое гиперплазия и чем она опасна

Плацента является одним из самых важных временных органов беременности. Еще несколько десятков лет назад функцию плаценты можно было оценить лишь косвенно — по состоянию самого плода. Если плод в порядке, значит и плацента работает хорошо. С развитием медицины и, особенно, ультразвуковой диагностики, стало возможным исследовать плаценту внутриутробно.

Что такое гиперплазия плаценты?

Гиперплазия — это древнегреческое слово, означающее «чрезмерное развитие», «увеличение». Этот термин применим к любому органу человеческого тела. В случае с плацентой термин гиперплазия обычно подразумевает увеличение ее толщины, массы и окружности. Однако на ультразвуковом сканировании возможно точно измерить только толщину плаценты, поэтому отталкиваются именно от этого показателя. Хочется отметить, что единичное ультразвуковое исследование неправомочно ставить диагноз гиперплазии плаценты. Необходимо динамическое наблюдение беременной, мнение нескольких врачей, расширенные исследования. Тем более недопустима самостоятельная оценка результатов УЗИ.

Гиперплазия или диффузное утолщение плаценты подразумевает ее отек, а также компенсаторное увеличение количества структурных единиц. Причин тому несколько:

  1. Инфекции. Это, пожалуй, самая частая причина утолщения плаценты. Бактерии, вирусы и другие чужеродные агенты могут проникать в полость матки, околоплодные оболочки и воды как восходящим путем из влагалища, так и с током крови из других очагов. Плацента редко инфицируется изолированно. Воспаление детского места называется плацентит и очень часто он сочетается с воспалением плодных оболочек и внутриутробным инфицированием плода. При развитии воспалительного процесса происходит отек плаценты и кажущееся увеличение ее толщины.
  2. Иммунологический конфликт матери и плода, например по резус-фактору. В этом случае картина будет сходна инфекционному процессу, только поражают ткань плаценты не вирусы и бактерии, а антитела матери. Говоря простым языком, в этом случае организм матери пытается убить плод и все временные органы беременности, принимая их за чужеродные.
  3. Тяжелый или длительно текущий гестоз. При гестозе повышается артериальное давление, появляется белок в моче и нарастают отеки, в том числе и скрытые. К таким скрытым отекам относится и отек плаценты. Кроме этого, гестоз поражает сосудистую сеть плаценты, также приводя к отеку.
  4. Тяжелая анемия у матери. При падении уровня гемоглобина ниже 80 г/л плод начинает испытывать кислородное голодание. В этом случае плацента начинает расти компенсаторно, чтобы увеличить площадь газообмена и таким образом помочь плоду.
  5. Природная особенность. Не нужно исключать возможность увеличения плаценты просто как варианта развития. Часто у крупных детей бывают массивные плаценты, или эта особенность передаются в поколениях.

Очень часто утолщение плаценты сочетается с многоводием или маловодием, а так же расширением межворсинчатых пространств (МВП) плаценты. В первых двух случаях это дополнительные проявления инфекции или иммунного конфликта. Расширение МВП говорит о том, что плацента пытается компенсировать свою функцию. Изолированное расширение МВП не является диагнозом, а лишь может подразумевать инфекционный процесс, анемию, фетоплацентарную недостаточность или просто особенность развития.

Симптомы и диагностика гиперплазии плаценты

Плацента лишена болевой иннервации, поэтому при начальных признаках ее поражения ничего не беспокоит беременную. Обычно основные симптомы появляются спустя недели и даже месяцы.

  • Основными симптомами нарушения функции плаценты являются признаки кислородного голодания плода: задержка его роста, нарушение плодово-маточных кровотоков, острая гипоксия. Женщина отмечает уменьшение шевелений плода, снижение его активности. Врач при осмотре обращает внимание на снижение темпов роста живота беременной, плохие показатели сердцебиения или кардиотокографии.
  • Проявления инфекционного процесса также могут выступать как основные жалобы. Беременная жалуется на повышенную температуру, слабость, головные и мышечные боли, ознобы, выделения из половых путей. Часто при расспросе женщина вспоминает про недавнее обострение хронического воспалительного процесса (отит, синусит, пиелонефрит) или острое заболевание (ОРВИ, грипп, ангина, тромбофлебит).
При обнаружении утолщения плаценты на очередном УЗИ необходимо выполнить так называемый диагностический поиск — ряд обследований для выявления возможных причин:
  • Общий анализ крови, мочи и биохимию крови для поиска воспалительных изменений, а также определения уровня гемоглобина и ферритина.
  • Посев и мазок из влагалища, исследование на инфекции передающиеся половым путем и группу TORCH.
  • Определение уровня антител к резус-фактору и группам крови для исключения резус-сенсибилизации.
  • Кровь на глюкозу.
  • Консультации терапевта и кардиолога для исключения гестоза, инфекциониста в сложных случаях внутриутробного инфицирования.

Постоянный КТГ-мониторинг и ультразвуковая допплерометрия плода входят в протоколы наблюдения таких беременных.

Гиперплазия плаценты: последствия для мамы и малыша

Так как плацента является временным органом для существования плода, то и последствия нарушения ее функций сказываются в основном на ребенке:

  • хроническая ;
  • задержка роста плода;
  • острая гипоксия плода;
  • внутриутробная гибель плода;
  • преждевременные роды .

Опасность для матери составляет не столько сама гиперплазия плаценты, сколько причина, вызвавшая ее. Гестоз и эклампсия, инфекционный процесс, тяжелая анемия безусловно грозят здоровью и жизни женщины.

Лечение утолщения плаценты

Терапия гиперплазии плаценты заключается в лечении непосредственной причины, вызвавшей данное осложнение:

  • Антибактериальная и противовирусная терапия в случае инфекции.
  • Лечение гестоза, а также скорейшее родоразрешение.
  • Лечение резус-конфликта, заключающееся в периодическом внутриутробном переливании крови плоду и плазмаферезе матери. В этом случае также показано максимально скорое родоразрешение с обязательной профилактикой резус-конфликта антирезусными иммуноглобулинами в следующей беременности.
  • Терапия препаратами железа анемии у беременной женщины, а также переливание эритроцитарной массы в случае снижения гемоглобина ниже 75 г/л.

Учитывая нарушенную функцию плаценты, показано применение различных препаратов, улучшающих плацентарный кровоток: Курантил, Актовегин, Пирацетам, Пентоксифиллин.

Александра Печковская, акушер-гинеколог, специально для сайт

Полезное видео:

Плацента – это временный орган, развивающийся в организме женщины при беременности. Детское место имеет сложное строение, оно соединяет мать с ребенком, не смешивая их кровеносные системы. Плацента формируется из ворсинок хориона с момента прикрепления плодного яйца к стенке матки, обеспечивает плод питательными веществами, снабжает кислородом, выводит продукты обмена, защищает от инфекций. Одна из ключевых функций – создание фетоплацентарного барьера.

Этот своеобразный фильтр защищает будущего ребенка от всего плохого. Начиная полноценно функционировать к 12 неделям, он пропускает одни вещества и задерживает транспортировку других, опасных для зародыша и плода. Детское место вырабатывает необходимые во время беременности гормоны и обеспечивает иммунологическую защиту плода.

Развитие и созревание

Определить эти параметры можно на УЗИ. Измеряются три размера: продольный с поперечным образуют два перпендикулярных отрезка, проведенные через наиболее удаленные друг от друга точки краев, и толщина (глубина).

Обычно плацента заканчивает свое формирование к 16 неделе беременности, при нормальном течении без патологий, и растет до 37 недели, достигая к этому времени максимальных размеров.

Первое измерение параметров детского места проводится в 20 недель. Дальнейшие – по показаниям. К концу срока вынашивания, толщина детского места уменьшается. Этот размер тоже имеет свои показатели в пределах нормы, в соответствии со сроком беременности. Может варьировать в определенных границах, пока нет опасности нарушения основных функций.

Кроме физиологической толщины плаценты, важным признаком нормального течения беременности считается степень зрелости детского места. Утолщение в комплексе с преждевременным старением (инволюцией), обычно указывает на патологию во время вынашивания. Снижение функциональной способности этого, важного для полноценного внутриутробного периода жизни ребенка органа, называется фетоплацентарной недостаточностью.

Периоды развития

По мере созревания, детское место проходит через ряд этапов. Они привязаны ко времени беременности и на определенном сроке должны соответствовать определенным параметрам. Выделяют 4 степени зрелости:

  • Нулевая степень – формируется орган однородной структуры, при нормальном течении до 30 недель.
  • Первая – рост и развитие органа, с появлением эхогенных вкраплений с 27 по 34 неделю.
  • Вторая – зрелая плацента, меняющая структуру, множественные включения, срок с 34 по 39 неделю.
  • Третья – время старения плаценты, наступает после 37 недели, структура приобретает дольчатость, появляются кальцификаты.

Нормальная толщина в среднем в миллиметрах близка по значению к сроку беременности по неделям, в 20 недель средняя величина утолщения равна 20 мм. В норме на ультразвуковом исследовании в 20 недель утолщение плаценты колеблется от 16,7 до 28, 6 мм.

Если утолщение имеет большие параметры, речь может идти о патологии. Толстая плацента не так хорошо справляется со своими задачами и нередко приводит к нарушениям жизнеобеспечения и развития плода, гормонального фона беременной.

Гиперплазия плаценты

Диагноз гиперплазия плаценты встревожит женщину и в 20 недель при первом измерении параметров на УЗИ, и в любом другом сроке.

Гиперплазия или утолщение плаценты – серьезная патология во время беременности, она способна привести к хронической фетоплацентарной недостаточности.

Излишнее разрастание тканей, причем необязательно – функциональных, нарушает поставку ребенку кислорода и питания. Выделительная функция тоже страдает. Это способно привести к замедлению развития плода, кислородному голоданию, потере веса и усложнению родов.

Чем угрожает патология?

Излишняя гиперплазия плаценты говорит о быстром росте и преждевременном старении органа с утерей его основных функций. Плацента меняет свою структуру на дольчатую, появляются кальцификаты, что нарушает нормальную поставку кислорода и необходимых питательных веществ от матери к плоду.

Ребенок начинает страдать от кислородного голодания и недостаточности питания, отставать в развитии. При тяжелых патологиях может быть внутриутробная гибель плода и преждевременная отслойка плаценты.

Нарушается эндокринная функция органа, что может спровоцировать замирание беременности или преждевременные роды.

Причины появления

Любые отклонения от нормы в организме беременной женщины не происходят без веского повода и требуют изучения. Этот тезис относится и к гиперплазии плаценты. Наиболее часто такое состояние провоцируется следующими факторами:

  • Анемия во время вынашивания, особенно тяжелые формы. Здесь речь идет о компенсаторном механизме.
  • Заболевания ОРВИ. Вирусы легко попадают в плаценту, разрушают клетки и нарушают их функцию.
  • Сахарный диабет. Гликозилированный гемоглобин и другие белки не способны адекватно выполнять возложенные на них задачи, сильно меняется обмен веществ.
  • Венерические и TORCH-инфекции в хроническом течении.
  • Гестоз на поздних сроках. Воздействие токсинов зачастую приводит к поражению участков плаценты и замещению нормальных тканей рубцовыми.
  • Многоплодная беременность. Здесь более-менее вариант нормы: чтобы обеспечить всем необходимым несколько детишек, приходится увеличиваться в размерах.
  • Низкий или избыточный вес матери.
  • Резус-конфликт между кровью матерью и плода. Очень серьёзная причина. Косвенно указывает на то, что фетоплацентарный барьер поврежден, произошел контакт крови матери с эмбриональной и есть риск гибели плода.

При сахарном диабете у мамы, есть еще один фактор утолщения плаценты: для беременных женщин с такой патологией характерно развитие крупного плода. Чтобы обеспечить его всем необходимым, детское место тоже вынуждено увеличиваться.

Гестационная трофобластическая болезнь

Один из вариантов течения иногда называется неполным пузырным заносом. Возникает в случае, если одну яйцеклетку оплодотворяют одновременно два сперматозоида, что приводит к генетической аномалии эмбриона. Встречается нечасто, но требует особого внимания, так как может вызывать онкологическую патологию.

Хромосомные нарушения в 90% случаев приводят к раннему прерыванию беременности, но в 10% вынашивание не останавливается. Плацента утолщается местами, размеры матки соответствуют сроку беременности. Даже выслушивается сердцебиение плода.

Диагноз ставится только при ультразвуковом обследовании и чем раньше, тем лучше. Единственный вариант помощи – выскабливание.

Клинические проявления и диагностика

Внешняя симптоматика плацентарной гиперплазии любого генеза, как правило, отсутствует. Симптомы на ранних сроках не проявляются, диагноз устанавливается на очередном ультразвуковом исследовании, начиная с 20 недели беременности. Толщина плаценты измеряется в самых широких местах.

Никаких симптоматических проявлений аномального утолщения плаценты на ранних сроках до 20 недель нет.

Этот орган не имеет болевых нервных окончаний, поэтому самостоятельно заподозрить гиперплазию можно только по косвенным признакам:

  1. На более поздних сроках, когда уже слышно шевеление, в 18–20 недель, отмечается изменение движений плода от активизации до замедления.
  2. Появление или нарастание интенсивности гестоза, особенно – на ранних сроках.
  3. Практически всегда отмечается нарушение сердцебиения при прослушивании на кардиотокографии.

По результатам обследований. врач выясняет причины, назначает беременной дообследование (при необходимости) и проводит симптоматическое лечение исходя из причин, вызвавших утолщение.

УЗИ диагностика

Для определения толщины детского места, УЗИ проводят, начиная с 18–20 недель. Затягивать с этим исследованием не стоит, так как аномалии плаценты, выявленные на ранних сроках, легче компенсировать. Важнейшие показатели:

  1. Соответствие степени зрелости плаценты сроку беременности.
  2. Однородность структуры.
  3. Физиологическая плотность ткани.
  4. Наличие или отсутствие дополнительных долек.

При сохранении структуры и незначительном утолщении плаценты, никаких мероприятий не требуется, проводится наблюдение в динамике.

Важнейшим показателем является состояние плода и какое влияние на его рост и развитие оказывает утолщение плаценты, влияет ли оно на нормальное течение беременности.

Более информативного метода выявления плацентарной патологии, чем УЗИ нет. Поэтому пренебрегать сроками исследований нельзя.

Профилактика осложнений

Если в сроке до 20 недель на УЗИ установили утолщение плаценты, не надо паниковать: врач выяснит причины и даст рекомендации по профилактике фетоплацентарной недостаточности. При необходимости, будет проведено лечение.

Сама женщина может хорошо поспособствовать профилактике осложнений:

  • Нужно чаще бывать на воздухе.
  • Отказаться от вредных привычек.
  • Хорошо и качественно питаться.
  • Избегать контактов с вирусными инфекциями.
  • Лечить хронические инфекции на стадии планирования беременности.
  • Контролировать свой вес, потребление витаминов.
  • Не допускать анемии, вовремя сдавая анализы.
  • Регулярно посещать женскую консультацию для раннего выявления причин, которые можно устранить.

Если плацента слишком толстая и причины выяснены, специалист назначает терапию в соответствии со сроком, чтобы улучшить обмен веществ, и поддержать плод в сложившихся условиях. Своевременно принятые меры значительно повышают шансы родить нормального ребенка даже при значительном утолщении плаценты.

Гиперплазия плаценты ― это опасное заболевание, угрожающее как здоровью матери, так и благополучию малыша. Когда детское место растет на 1, 3 или 21 неделе ― это нормально. Но когда орган постоянно и быстро утолщается на 32-34 или даже 36 неделе, достигая величины в 40 мм и более ― необходимо обратиться к лечащему врачу.

Функции плаценты

Плацента, развивающаяся в женском организме с момента начала беременности, ― это важнейший орган, обеспечивающий жизнь, здоровье и нормальное развитие ребенка. Она играет роль своеобразного пути между телом матери и малыша. Через плаценту происходит обмен всеми полезными веществами.

Она напрямую связана с дыхательной системой. Через этот орган проходит естественный воздухообмен. Кислород поступает в тело плода, а углекислый газ обратно выводится в тело беременной.

Этот же орган отвечает и за пищеварение: через него организм передает ребенку все возможные питательные вещества, поступающие к матери. После примитивного процесса усвоения ребенок «выбрасывает» все отходы своей жизнедеятельности через импровизированный мост.

Именно плацента защищает ребенка от отторжения иммунитетом матери. Она не пропускает к плоду агрессивные клетки, тем самым оберегая дитя вплоть до его рождения. Напротив, антитела для борьбы с инфекциями пропускаются, чтобы не допустить развития заболеваний в утробе.

Наконец, этот орган вырабатывает необходимые при беременности и родах гормоны. Поэтому умеренное развитие и рост плаценты ― это нормальное явление, позволяющее выносить и родить долгожданного ребенка.

Доступно о плаценте на видео:

Что такое гиперплазия и чем она опасна

Термин «гиперплазия» существует не только у беременных. Он обозначает целую группу заболеваний, связанных с утолщением того или иного органа. Чаще всего встречается гиперплазия матки и предстательной железы. Фактически, это патология, при которой в тканях или органах пациента скапливается большое количество клеток. Из-за этого он начинает разрастаться и увеличиваться в размерах. Вопреки распространенному стереотипу, никакого отношения к онкологии заболевание не имеет.

Гиперплазия плаценты ― это, соответственно, увеличение упомянутого органа при беременности. Ее стенки значительно утолщаются, доходя до 4 и более см. При этом сам орган не слишком увеличивается в размерах. Чем опасно такое состояние?

Поскольку питание ребенка происходит через стенки соединительных тканей, их утолщение затрудняет процесс. Ребенок испытывает дефицит полезных веществ и кислорода. Грозит это появлением внутриутробных пороков развития.

Незначительная форма не несет в себе особой опасности. Но при значительном утолщении стенок ребенок не может появиться на свет. Появляется необходимость провести кесарево сечение. Если это сочетается с маловодием, костно-мышечный аппарат ребенка развивается некорректно. Появляются смещения или сращения отдельных костей. Все это в сумме может привести к гибели ребенка на ранних сроках.

Почему возникает гиперплазия плаценты

Различные последствия и причины гиперплазии разнообразны, поэтому для правильной диагностики следует собрать полноценный анамнез. Чтобы выявить причину развития заболевания, проводят несколько исследований.

Если было обнаружено утолщение плаценты с явным расширением МВП (межворсинчатых пространств), причиной этому стало инфекционное заболевание. Оно могло быть перенесено как ребенком, так и матерью с последующей передачей бактерий в организм плода.

Локальное или диффузное утолщение указывает на тяжелую форму анемии. Симптомы заболевания часто списываются на банальную усталость, в результате чего беременная не получает своевременной диагностики.

Сахарный диабет ― еще одна распространенная причина. С таким диагнозом необходимо назначить поддерживающую терапию. Все время вынашивания плода больную должен курировать личный врач.

Гестоз ― опасная болезнь, проявляющая себя судорогами, отеками и потерями сознания. Диагностировать ее можно по утолщению плаценты на поздних сроках. Если вовремя не заметить симптом, можно потерять и ребенка, и его мать.

Патология возникает и из-за резус-факторов. Если у матери он положителен, а у ребенка ― отрицателен, организм настойчиво отвергает плод.

Признаки утолщения

Эхопризнаки ― это совокупность определенных признаков, выявляемых при ультразвуковом обследовании. Чаще всего патологии выявляются с их помощью. Эхопризнаки характерны для любого триместра ― хоть для 1, хоть для 20 недели.

При обследовании на УЗИ наблюдается значительное увеличение межворсинчатого пространства. Это ― первый признак развивающейся патологии. Если своевременно начать лечить болезнь, она не принесет никакого вреда. Сам ребенок перестает активно двигаться, что можно определить по самоощущениям женщины. Он не шевелится, не меняет своего положения. Любые перемещения вялые и редкие.

На первоначальном осмотре сложно услышать биение сердца ребенка. Со временем оно или сильно замедляется, или ускоряется. Любой звук приглушается толстыми стенками плаценты.Так называемой «воды» становится слишком много. Объем анемической жидкости постоянно увеличивается. Возникает угроза многоводия, опасного для здоровья и развития малыша.

На ранних стадиях выявить гиперплазию невозможно, если только в организме не развивается ее ярко выраженная форма. Большинство симптомов дают о себе знать в последнем триместре.

Методы диагностики

Дабы понять, что делать с больной, и вылечить патологию, гиперплазию следует вовремя диагностировать. Для этого существует несколько методов, способных рассказать про преждевременное созревание или гиперплазию больше.

Для начала проводится первичный осмотр. Обычно он проводится раз в месяц, чтобы исключить всевозможные патологии развития плода. Если были обнаружены признаки, описанные выше, женщин отправляют на дополнительную диагностику.

В первую очередь проводится ультразвуковое обследование, делаются все необходимые замеры. Полученные результаты сравниваются с нормальными. Если что-то отклоняется от нормы на большую величину, УЗИ могут провести повторно.

Назначается подробная кардиография плода. Кровь и моча беременной берутся на анализ, чтобы исключить развитие внутриутробных инфекций. Лечащий врач берет небольшой гинекологический мазок, исследуя микрофлору влагалища, ее состав и наличие дополнительных микроорганизмов.

Способы лечения

Лечение бывает как стационарным, так и домашним. Этот выбор зависит от того, в каком состоянии находится плод и его мать. Если жизни и здоровью что-нибудь угрожает, назначается немедленная и экстренная госпитализация.

В первую очередь женщине назначаются определенные медицинские препараты: Тивортин и Актовегин. Они разжижают кровь, способствуют увеличению газообмена между матерью и ее чадом, ускоряют микроциркуляцию крови в органе. Помимо этого назначаются лекарства, предотвращающие разрушение клеток.

Если гиперплазия была вызвана каким-либо заболеванием, назначается соответствующее лечение. Особое внимание уделяют при двойне: один брат при недостатке витаминов легко может поглотить другого. Если болезнь опасна, женщину кладут в стационар.

Также проводится противовирусная терапия. Если симптомы неиммунные, проводится профилактика. Женщина пьет витамины и витаминные комплексы.

Возможные осложнения

Сама по себе гиперплазия не настолько опасна, как возможные осложнения после нее.

Если плод недополучает многих полезных веществ, это говорит об значительной задержки в развитии. Она может выявить себя как во время беременности, так и после родов. Не исключены различные умственные патологии. Осложнения проявляют себя и на опорно-двигательной системе. Она может развиваться с патологиями. Не исключены серьезные сращения, отмирания конечностей или иные последствия.

Отражается гиперплазия и на родовом процессе. Нормальное родоразрешение становится невозможным. Возникают различные трудности, необходимость кесарева сечения ― об этом говорят даже отзывы беременных, у которых диагностировали гиперплазию детского места.

Профилактические меры

Склонность к гиперплазии встречается у многих женщин, соблюдали ли они меры профилактики или нет. Однако те, кто рожал с таким диагнозом, могут подтвердить: своевременная диагностика легко нивелирует все возможные последствия заболевания.

Достаточно никогда не забывать о профилактических осмотрах. О любых нестандартных симптомах следует сообщать лечащему врачу. Нельзя отказываться от дополнительных методов диагностики, если они необходимы.

Перед планированием беременности пройдите все необходимые обследования. При выявлении любых инфекций нужно полностью излечить их. Даже незначительная болезнь во время ожидания малыша может перейти в острую стадию.

Во время вынашивания также не следует игнорировать начала любых болезней. Обычная простуда при «правильном» протекании вызывает острую гиперплазию. Тщательно следуйте указаниям врача.

Повышайте иммунитет. Гуляйте на свежем воздухе и правильно питайтесь, не забывая про овощи и фрукты. Период вспышек инфекций отсидите дома, ежедневно проводя влажную уборку.

Заключение

Если своевременно выявить даже небольшое утолщение плаценты, можно спасти жизнь своему ребенку. На ранних стадиях заболевание легко лечится с помощью антибиотиков и иных лекарств. Главное ― не затягивать, пока не станет слишком поздно.

Гиперплазия плаценты при беременности – это диагноз, который указывает на утолщение эмбрионального органа и возможное возникновение осложнений.

Детское место окончательно формируется к началу второго триместра и до 36-37 недели только продолжает развитие и рост совместно с плодом. При ультразвуковом исследовании измеряют толщину оболочки, как правило, около пуповины, и сравнивают с показателями нормы. Гиперплазия плаценты при беременности определяется в случае явного утолщения, что говорит о снижении функциональности органа.

Условные нормы созревания

Формирование временного эмбрионального органа в период вынашивания очень важно, т.к. от него зависит жизнеспособность ребенка. Кислород, питательные вещества и защитные функции доставляет по кровеносным сосудам именно плацента, которая в процессе родовой деятельности прекратит свое существование.

Существует 4 условные стадии развития, каждой из которых соответствует определенный показатель:

  1. 0 степень созревания длится до 30 недели и характеризуется интенсивным ростом, вплоть до 30,5 мм.
  2. 1 степень определяется с 27 по 36 неделю и обуславливается параметрами от 27,8 мм до 35,6 мм.
  3. 2 степень подразумевает формирование временного органа с 34 по 39 недели, с показателями, которые могут колебаться в пределах 34-35 мм.
  4. 3 степень определяется после 36 недели, а толщина может достигать 34 мм. Наблюдается период старения с подготовкой к родовой деятельности.
Гиперплазия плаценты при беременности предполагает значительное превышение нормальных показателей толщины. При диагностировании специалисты учитывают также и индивидуальные особенности женского организма, ее телосложение.

Ультразвуковое исследование не является единственным аргументом для постановки диагноза и назначения лечения. Применяются дополнительные обследования для того, чтобы определить гиперэхогенные включения в плаценте при беременности. Этот показатель указывает на повышенное содержание кальцинатов, что в свою очередь говорит о преждевременном старении оболочки и наличии гипоксии у плода.

Причины гиперплазии у беременных

Основной причиной формирования гиперплазии считаются инфекционные заболевания. Вредоносные бактерии проникают в полость матки восходящим путем, таким образом, воспаляется детское место и одновременно с утолщением возникает плацентит. Заболевание, которое опасно для жизнедеятельности младенца.

Другими, не менее важными факторами риска являются:

  • конфликт резус-фактора матери и младенца;
  • гестоз, который приводит к отечным реакциям;
  • анемия приводит к кислородному голоданию ребенка;
  • аномальные проявления, связанные с наследственностью.
Не редко, гиперплазия при беременности, сопровождается многоводием или, наоборот, маловодием.

Чем опасна гиперплазия для беременности

На ранних сроках патологию невозможно определить. Только после первого УЗИ, специалист способен предоставить предварительные параметры толщины.

Во втором триместре, когда чувствуется движение плода в утробе, по характеру шевелений, слишком быстро или медленно, можно заподозрить патологию. Сердцебиение младенца имеет характерные черты тахикардии или брадикардии. Резкие скачки сердцебиения у младенца обуславливаются кислородным голоданием. Поэтому после ультразвукового исследования требуется пройти обследование при помощи кардиотокографа.

Утолщение оболочки приводит к преждевременному старению органа, ребенок недополучает питание, защита эмбриональной оболочки снижается. Возникает угроза задержки внутриутробного развития, преждевременных родов и самопроизвольного выкидыша.

Чем лечить гиперплазию плаценты при беременности?

Если наблюдается незначительные признаки, то часто врачи принимают решение о наблюдении за пациенткой. Лечение в таком случае не понадобится, только строгий контроль над функционированием детского места.

После подтверждения диагноза, специалистами назначается курс лечения общей направленности:

  • улучшение кровообращения;
  • препараты для разжижения крови;
  • средства для повышения уровня гемоглобина;
  • активизация обмена веществ;
  • витаминный комплекс с обязательным содержанием фолиевой кислоты.
Если гиперплазия возникла по причине заражения инфекцией, то, прежде всего, лечить начинают первоисточник патологии – назначаются антибактериальные и противовирусные средства.

При конфликте резус-факторов матери и ребенка рекомендуется прерывание вынашивания плода, так как ситуация связана с большими рисками для жизни. Часто применяют переливание крови для нормального внутриутробного развития плода.

Плацента – это временный, но крайне важный орган, который появляется только во время беременности и обеспечивает все потребности растущего в утробе малыша. Различные неблагоприятные факторы могут повлиять на состояние плаценты и ухудшить ее функции. В этих случаях говорят о плацентарной недостаточности, разновидностью которой является утолщение плаценты.

Что это такое гиперплазия плаценты

Гиперплазия или утолщение плаценты — это структурная патология органа, которая сопровождается увеличением толщины внезародышевого слоя. При этом состоянии ее толщина выше установленных физиологических норм, которые определяют на определенных сроках беременности (начиная примерно с 21-22 недели).

Гиперплазия плаценты мешает ей полноценно выполнять свои функции, связанные с обеспечением плода кислородом и необходимыми питательными веществами. В связи с этим замедляется его развитие, что может привести к необратимым последствиям.

Что может стать причиной

Окончательно сформировавшись к 16-ой неделе беременности детское место продолжает расти вместе с плодом. Его толщина постепенно увеличивается и к 36-37 неделе составляет от 2 до 4 см.

В таблице ниже приведены ориентировочные нормы толщины детского места на разных сроках беременности.

Причины этого состояния связывают со следующей патологией:

  1. Несовместимость матери и плода по иммунологическим показателям крови (гемолитическая болезнь). Возникает при несовпадении групп крови или резус-фактора.
  2. Тяжелая анемия с уровнем гемоглобина ниже 70 г/л.
  3. Сахарный диабет, в частности и тот, который развивается только при беременности.
  4. Наличие инфекционной патологии у беременной, так называемые TORCH-инфекции: цитомегаловирус, герпес, краснуха и другие.
  5. Тяжелые гестозы при беременности (эклампсия, артериальная гипертензия).
  6. Инфекции мочеполовой системы (хламидии, уреаплазмы, гонококки, сифилис).
  7. Генетические проблемы.
  8. Инфекционные болезни во время беременности (грипп, энтеровирусная инфекция и др.).

Важно! Чаще всего при увеличении толщины плаценты, специалисты подозревают гемолитическую болезнь. Если диагноз не подтверждается, то начинают искать другие причины.

Как проявляется эта патология

Беременная женщина первое время не ощущает никаких признаков того, что происходит гиперплазия плаценты. Выявить это состояние помогает ультразвуковое исследование, которое проводят на определенных сроках.

Позднее женщина может заметить изменение двигательной активности плода. Малыш начинает реже двигаться. При осмотре доктор отмечает уменьшение частоты сердечных сокращений и глухость сердечных тонов. Эти симптомы являются следствием кислородного голодания плода и могут стать косвенным признаком увеличения толщины плаценты.

Гиперплазия плаценты впоследствии приводит к гипоксии (кислородному голоданию) плода и задержке внутриутробного развития. Если вовремя не принять необходимые меры, то последствия могут быть необратимыми.

Важно! Плацентарная недостаточность может начаться в любом триместре беременности, но ее осложнения для плода проявляются в основном в третьем триместре, когда идет интенсивный рост и созревание всех систем и органов малыша.

Как происходит диагностика

Диагностика этой проблемы проводится с помощью . Этот метод позволяет установить параметры плаценты и выявить ее утолщение.

Кроме этого, проводят допплерографию. Это исследование сосудов, которое позволяет уточнить состояние кровотока в системе мать-плод.

КТГ (кардиотокография) помогает выявить частоту сердечных сокращений плода и его активность. Снижение этих показателей может быть косвенным признаком того, что произошло плацентарное утолщение.

Дополнительно, при постановке этого диагноза, беременную женщину направляют на сдачу общеклинических анализов крови и мочи, а также проверяют на наличие инфекционной патологии (гистология, цитология мазков, анализы крови и др.).

Понятие о хорионангиоме

Хорионангиома – это доброкачественная сосудистая опухоль плаценты. Она развивается из мелких капилляров, расположенных в ворсинах хориона.

В большинстве случаев это одиночное новообразование, но может быть представлена несколькими узлами. Локализуется на внутренней поверхности плаценты, реже — на других участках.

Гистология определяет эту опухоль, как гамартому, новообразование из клеток сосудистого эпителия. Течение ее доброкачественное, метастазы в другие органы и ткани она не дает.

Потенциальный риск для плода может быть связан с развитием плацентарной недостаточности. Это образование может забирать на себя часть крови, тем самым вызывая синдром обкрадывания плода. В таких случаях наблюдается гипоксия и задержка внутриутробного развития.

Симптомы и состояние беременной зависят от размеров и локализации опухоли. Единичные небольшие хорионангиомы ничем не проявляют себя и беременность протекает без осложнений. Диагностируют на основании данных и допплерографии.

Что применяют для лечения гиперплазии плаценты

Терапия этого патологического состояния проводится в нескольких направлениях. Специалисты занимаются лечением основного заболевания и сопутствующих осложнений беременности.

Параллельно терапия направлена на улучшение маточно-плацентарного кровообращения. Это достигается с помощью применения комплекса сосудорасширяющих средств, а также препаратов, улучшающих свойства крови и расслабляющих мускулатуру матки.

При иммунологических причинах специалисты могут порекомендовать женщине прервать беременность или назначить курс интаперитонеальной гемотрансфузии — переливание очищенных эритроцитов с отрицательным резус-фактором внутриутробно.

Рекомендуем также

что такое гиперплазия плаценты — 25 рекомендаций на Babyblog.ru

Этот удивительный орган формируется и функционирует только во время беременности, сразу же после рождения малыша детское место покидает материнский организм. С латыни «плацента» переводится как «лепешка». Такое название дано плаценте за ее внешний вид, ведь внешне она напоминает большую круглую лепешку или диск, к центру которого крепится пуповина.

Плацента, или детское место, начинает формироваться практически с момента прикрепления яйцеклетки к стенке матки, или, как говорят доктора, с момента имплантации яйцеклетки в полость матки. Сначала, с 9 дня после зачатия и до 13-16 недели беременности, развивается предшественник плаценты — ворсинчатый хорион. Клетки трофобласта, которые окружают зародыш, интенсивно делятся, и вокруг эмбриона образуется ветвистая оболочка из ворсин. В каждую подобную ворсинку врастают сосуды зародыша.

На сроке 16 недель хорион превращается в плаценту, которая имеет 2 поверхности: одна обращена к малышу и называется плодовой, другая, которая называется материнской, в сторону внутренней стенки матки. К плодовой стороне крепится пуповина будущего человечка, а внутри ее ворсин протекает кровь малыша. Снаружи эти ворсины омываются кровью матери. Материнская сторона плаценты разделена на 15-20 долек, отделенных друг от друга перегородками.

Таким образом, в плаценте присутствуют 2 системы кровеносных сосудов — малыша и мамы. И именно здесь происходит постоянный обмен веществ между мамой и ее будущим ребенком. При этом кровь матери и ребенка нигде не смешивается, так как две сосудистые системы разделены плацентарным барьером — особой мембраной, которая пропускает одни вещества и препятствует проникновению других. Полноценно трудиться плацентарный барьер начинает к 15-16 неделям.

Окончательно структура плаценты формируется к концу I триместра, но ее строение продолжает изменяться в зависимости от развития малыша и роста его потребностей. Причем поначалу плацента растет быстрее, чем ребенок. Например, в 12 недель беременности будущий кроха весит 4 г, а плацента — уже до 30 г. К концу беременности детское место становится более компактным, плотным и принимает форму диска. С 22 по 36 неделю беременности масса плаценты постоянно увеличивается, и ближе к моменту родов диаметр плаценты будет около 15-18 см, толщина — 2-3 см, а весить она будет 500-600 г, то есть 1/6 от веса малыша. После 36-37 недели рост плаценты прекращается, ее толщина немного уменьшается или остается на прежнем уровне.

ДЛЯ ЧЕГО НУЖНА ПЛАЦЕНТА?

Как мы уже говорили, в плаценте происходит постоянный обмен веществ между будущей мамой и ее ребенком. Из крови женщины поступают кислород и питательные вещества, а малыш «возвращает» продукты обмена и углекислый газ, которые надо выводить из организма.

Плацента также защищает малыша от неблагоприятного воздействия: плацентарный барьер задерживает содержащиеся в материнской крови бактерии, некоторые вирусы, антитела мамы, вырабатывающиеся при резус-конфликте, но беспрепятственно пропускает кислород, питательные вещества и защитные белки матери к ребенку. Но защитная функция плаценты избирательна. Одни и те же вещества по-разному преодолевают барьер в сторону крохи и в сторону матери. Например, фтор прекрасно проходит от мамы к малышу, но совершенно не проникает в обратном направлении. Бром проникает к малышу намного быстрее, чем обратно.

Кроме того, детское место играет роль железы внутренней секреции, вырабатывая гормоны, которые поддерживают беременность, готовят грудь к лактации, а организм мамы — к успешным родам.

НА ЧТО ОБРАЩАЕТ ВНИМАНИЕ ДОКТОР?

Делая УЗИ на разных сроках беременности, доктор внимательно следит за состоянием плаценты. Для него важны:

1. Место расположения и прикрепления плаценты, а также ее приращение

При нормально протекающей беременности плацента чаще всего располагается в слизистой оболочке передней или задней стенки матки. На ранних сроках беременности детское место нередко доходит до выхода из матки. И тогда женщина слышит термин «низкое прикрепление плаценты».

Но волноваться преждевременно: надо учитывать, что у большинства женщин при увеличении размеров матки плацента поднимается вверх. Существует даже термин «миграция плаценты». Перемещение происходит за счет того, что нижний сегмент матки во время вынашивания ребенка изменяет свое строение, и плацента растет к дну матки (ее верхнего сегмента), ведь эта часть матки лучше снабжается кровью. «Миграция» плаценты протекает в течение 6-10 недель и заканчивается к 33-34 неделе беременности. По этой причине диагноз «низкое расположение (прикрепление) плаценты» пугать не должен. Такое положение до 32-й недели сохраняется лишь у 5% женщин, и только у трети из этих 5% плацента остается в таком же положении и к 37-й неделе. В последнем случае врачи решают вопрос о тактике ведения родов и методе родоразрешения. Ведь низкое расположение детского места чревато отслойкой плаценты до рождения ребенка, что опасно и для мамы, и для крохи. При таком осложнении женщину госпитализируют. Если отслойка незначительна, симптомы выражены слабо, чтобы ее замедлить или прекратить, в родах вскрывают плодный пузырь. Если же начинается внутреннее кровотечение и его симптомы (учащение пульса, снижение артериального давления, сильные боли в матке) нарастают, прибегают к кесареву сечению.

Если плацента доходит до внутреннего зева матки (выхода из матки) или перекрывает его, говорят о предлежании плаценты. Чаще всего это встречается у неоднократно беременевших и рожавших женщин. Способствуют предлежанию плаценты и аномалии развития матки. Но определенное на УЗИ в ранние сроки предлежание плаценты на поздних сроках может не подтвердиться. Тем не менее врачи настороженно относятся к подобной ситуации, так как она может спровоцировать кровотечения и преждевременные роды. По этой причине, чтобы не пропустить подобное осложнение, с интервалом 3-4 недели будущей маме будут делать УЗИ на протяжении всей беременности, а также перед родами. Тактика ведения беременности и родов при предлежании плаценты такая же, как и при низком ее расположении.

Ворсины хориона (предшественника плаценты) в процессе образования детского места «прорастают» в слизистую оболочки матки — эндометрий. В очень редких случаях бывает, что ворсины прорастают в мышечный слой или в толщу стенки матки. В таком случае говорят о приращении плаценты, которое чревато кровотечением после рождения ребенка. Если подобное происходит, приходится делать операцию — удалять плаценту вместе с маткой.

Если ворсины хориона проросли не столь глубоко, говорят о плотном прикреплении плаценты. Оно обычно встречается при низком расположении плаценты или ее предлежании. Увы, распознать приращение или плотное прикрепление плаценты можно только во время родов. В последнем случае врач, принимающий роды, будет отделять плаценту вручную.

2. Степень зрелости плаценты

Плацента растет и развивается вместе с ребенком. С помощью УЗИ доктор определяет степень ее зрелости — строение на определенном сроке беременности. Это нужно, чтобы понять, хватает ли ребенку питательных веществ и как плацента справляется со своими задачами.

Выделяют 4 степени зрелости плаценты: нулевую, первую, вторую и третью. Когда беременность протекает нормально и без осложнений, до 30 недели плацента находится в нулевой степени зрелости. Мембрана у нее в этот период гладкая, структура — однородная. На сроке 27-34 недели плацента достигает первой степени зрелости. Мембрана становится слегка волнистой, структура — неоднородной. В 34-37 недель беременности говорят уже о второй степени зрелости. В некоторых местах этот орган истончается, начинает покрываться известковыми (солевыми) отложениями, но это не мешает плаценте справляться со своими функциями. С 37 недели беременности и до момента родов плацента должна пребывать в третьей степени зрелости. В этот период плацента делится на дольки, в мембране появляются заметные углубления.

Если степень зрелости меняется раньше времени, это может говорить о преждевременном созревании (старении) плаценты. Оно может возникнуть из-за нарушения в плаценте кровотока. Причиной последнего становится, например, такие серьезные осложнения беременности, как преэклампсия и анемия. В то же время подобный процесс может быть и индивидуальной особенностью материнского организма. Так что не стоит расстраиваться раньше времени. Обычно в такой ситуации женщине делают допплерометрию и наблюдают за маточно-плацентарным кровотоком и развитием ребенка. Если малыш не страдает, значит, все в порядке. Женщине порекомендует лишь профилактическое лечение. Когда же появляются настораживающие симптомы, будущую маму направляют в стационар. Там доктора снижают тонус матки, что облегчает доставку ребенку питательных веществ. Кроме того, врачи стараются улучшить кровообращение у будущей мамы и ее малыша.

Стремительное старение плаценты может быть и результатом перенесенных во время беременности инфекционных заболеваний (например, внутриматочной инфекции) или вредных привычек, например, курения. Также подобная ситуация возникает, если у женщины есть хронические заболевания, как сахарный диабет, или беременность осложняется резус-конфликтом.

В очень редких случаях речь может идти о позднем созревании плаценты. Иногда это может косвенно указывать на врожденные пороки развития плода.

3. Толщина плаценты и ее размеры

Толщину можно определить после 20 недели беременности. Если беременность протекает нормально, этот параметр до 36 недели все время увеличивается. На 7-й неделе она будет составлять 10-11 мм, на 36-й — максимум 35 мм. После этого рост плаценты останавливается и ее толщина не только не меняется, но может даже уменьшаться. Последнее будет первым симптомом старения. На 40-й неделе стареющая плацента является показанием к стимуляции еще не наступивших родов.

О тонкой плаценте говорят, если в III триместре толщина менее 20 мм. Подобная ситуация характерна для преэклампсии (повышение артериального давления, отеки и белок в моче). При этом есть угроза прерывания беременности и гипотрофии плода (отставание в росте). Когда при резус-конфликте возникает гемолитическая болезнь плода (организм резус-отрицательной мамы вырабатывает антитела к резус-положительным эритроцитам ребенка, и последние разрушаются) о нарушениях свидетельствует толстая плацента (толщина 50 мм и более). Похожие симптомы бывают и при сахарном диабете. Обе ситуации требуют лечения.

Размеры плаценты тоже могут не дотягивать до нормы или ее превышать. В первом случае при нормальной толщине меньше нормы оказывается площадь плаценты. Это может следствием генетических нарушений (таких, как синдром Дауна), преэклампсии и других осложнений. Из-за того, что маленькая плацента не может полноценно снабжать малыша кислородом и питательными веществами и выводить продукты обмена из организма, ребенок отстает в росте и весе. Подобное осложнение называется плацентарной недостаточностью. Те же последствия имеет и гиперплазия (увеличение размеров) плаценты. Своевременное лечение позволяет скорректировать развитие малыша.

ПОСЛЕДОВЫЙ ПЕРИОД РОДОВ

Как только рождается малыш и акушерка отрезает пуповину, плацента заканчивает свою работу. В течение 30 минут она выходит наружу вместе с плодными оболочками. В этом случае говорят, что рождается послед. Доктор прежде всего внимательно осматривает плаценту, измеряет и взвешивает. Все данные записываются в историю родов. Благодаря этому врачи получают ценную информацию о том, как проходила беременность и каково самочувствие ребенка. Если показатели отличаются от нормы, об этом сообщают педиатру.

Главное — плацента и плодные оболочки должны полностью покинуть организм женщины. Если после тщательного осмотра плаценты у врачей по этому поводу возникают сомнения, проводится ручной осмотр полости матки. Ведь оставшиеся в матке частички плаценты могут стать причиной кровотечения или воспалительного процесса. Это обследование и удаление неотделившихся частиц проводятся под наркозом.

После этого плацента врачей уже не интересует. Ее либо уничтожают, либо используют в научных или лечебных целях.

причины и последствия 🚩 гиперплазия при беременности 🚩 Заболевания

Плацента является временным органом и обеспечивает доставку кислорода и питательных веществ плоду. В ней происходит обмен между кровью матери и ребенка. Толщина плаценты вплоть до 37 недели беременности соответствует сроку в неделях. Так, в 20 недель ее толщина 20 мм, а в 25 – 25 мм. В 37 недель ее рост прекращается, а толщина достигает максимальных значений – 33, 75 мм. К моменту родов плацента может несколько истончиться, что является нормой.
Инфекционные заболевания половых органов, такие как хламидиоз, микоплазмоз, гонорея, ЗППП, особенно сифилис, и инфекционные заболеваний других органов чаще всего становятся причиной гиперплазии плаценты. В состоянии нездоровья организм не может контролировать правильность формирования плаценты – капилляры в ней располагаются хаотически, часть ткани склерозируется, в ответ на это появляются новые капилляры. В итоге кровообращение замедляется. У пациенток с сахарным диабетом нарушен синтез гормонов, в частности инсулина, который отвечает не только за углеводный обмен, но и выполняет множество других важных задач: угнетаются плацентарные ферменты, в ответ на это имеющиеся капилляры расширяются, что и вызывает гиперплазию.

Диагноз гиперплазии плаценты обычно ставят во время второго УЗИ в 18-23 недели беременности. Врач видит утолщение плаценты и расширение межворсинчатого пространства. Последнее происходит компенсаторно, чтобы обеспечить нормальное питание плода. Если плод не отстает в развитии, то акушер назначит лечение, которое позволит улучшить кровообращение в плаценте и ребенок рождается полностью здоровым. Женщина обязательно должна наблюдаться у акушера и делать диагностические УЗИ 2-3 раза в месяц или еженедельно. Это позволяет контролировать ситуацию.


Чаще всего при гиперплазии плаценты ребенок испытывает недостаток кислорода и питательных веществ. При умеренной гиперплазии возможны естественные роды, при ярко выраженной ребенок слишком слаб, чтобы родиться самостоятельно. Такие дети рождаются с малым весом, гипотрофией, проявлениями гипоксии. Современная медицина способна оказать им адекватную помощь, но риски некоторых осложнений сохраняются примерно в течение года.

Почти у всех беременных женщин с гиперплазией плаценты наблюдается фетоплацентарная недостаточность (ФПН). Это состояние нельзя вылечить, но можно компенсировать приемом специальных препаратов, которые улучшают кровообращение в плаценте. Задержка внутриутробного развития (ЗВР) плода является следствием фетоплацентарной недостаточности и встречается только при ярко выраженной ФПН. Степень ЗВР тоже различна. При вовремя назначенном лечении дети рождаются с недостатком массы тела, но в течение года «догоняют» сверстников в развитии.

Маловодие или многоводие разной степени диагностируют больше чем у половины женщин с гиперплазией плаценты. Оба состояния могут быть небезопасны для плода. При ярко выраженном маловодии наблюдается искривление костей скелета, сращение частей тела. Многоводие в этом плане менее опасно, но может спровоцировать другие осложнение беременности, например подтекание вод или преждевременные роды.

Внутриутробная гибель плода вследствие гиперплазии плаценты случается крайне редко, в основном у женщин, которые отказались от лечения. Опасна не сама гиперплазия, а осложнения, которые влечет за собой утолщение плаценты. Своевременно начатое лечение позволяет полностью или частично компенсировать недостаток питательных веществ. Дети рождаются здоровыми, если не было других причин, которые могли вызвать патологию плода.

симптомы, причины, лечение, профилактика, осложнения

У беременных, как и у любого человека, может возникнуть гиперплазия любой ткани и органа. Но наиболее частым случаем является гиперплазия плаценты. Этот патологический процесс может вызвать ряд причин:

  • Наличие в организме острых вирусных инфекций;        
  • Развитие тяжёлой формы анемии и как следствие снижение уровня гемоглобина;        
  • Сахарный диабет у будущей мамы;        
  • Хронические инфекции половой системы;        
  • Конфликт из-за разных резус-факторов у мамы и ребёнка;        
  • Поздний гестоз;        
  • Другие причины, которые врачи не могут выяснить при гиперплазии плаценты.

У беременных также может возникнуть гиперплазия молочных желёз. Это связано с подготовкой организма к кормлению будущего малыша. Из-за повышения выработки гормона пролактина происходит разрастание тканей груди. Это явление во время беременности не считается патологическим, так как выработка гормона снижается после прекращения грудного кормления.

Распознать гиперплазию какого либо органа при беременности сложно. При разрастании клеток плаценты первое время не проявляются признаки патологии. Выявить патологический процесс можно лишь с помощью некоторых видов обследований. Постепенно клетки плаценты начинают разрастаться и появляются первые признаки.

  • Шевеления плода становятся менее ощутимыми;        
  • Происходит отклонение сердечного ритма от нормы у ребёнка: может начаться тахикардия или брадикардия;        
  • При резком снижении сокращений сердца после кратковременной тахикардии происходит кислородное голодание плода или гипоксия;        
  • У беременных, страдающих сахарным диабетом, гиперплазия плаценты приводит к многоводию.

При гиперплазии других органов в период беременности будут наблюдаться другие симптомы. При видимом увеличении каких-либо органов, а также при повышении температуры тела и появления слабости, необходимо сказать об этих симптомах своему врачу.

Диагностика гиперплазии при беременности

Чтобы выявить патологическое разрастание тканей при беременности, необходимы определённые обследования. При подозрении на гиперплазию плаценты проводится УЗИ, КТГ, а также доплерография. С помощью УЗИ можно определить толщину плаценты. Картиотография или КТГ помогает узнать частоту сердечных сокращений будущего малыша, а также интенсивность сокращений маточных мышц. Доплеография необходима для определения скорости и направления кровотока в пуповинной артерии и изучения состояния сосудов плода и плаценты. Диагностировать гиперплазию других органов у будущей мамы можно также с помощью УЗИ и сдачи анализов.

Чем же опасна гиперплазия при беременности? Из-за этой патологии могут происходить нарушения функции повреждённых органов, и как следствие в работе организма возможны сбои. При гиперплазии плаценты вероятность осложнений зависит от причины возникновения и своевременного лечения. Если необходимые меры по улучшению состояния ткани плаценты дают положительный эффект, вероятность полноценного развития ребёнка и успешных родов высока. Но в некоторых случаях возможно осложнение в виде фетоплацентарной недостаточности. В этом случае плацента не в состоянии выполнять свои функции, что может привести к гипоксии, задержки развития плода и даже его гибели. На позднем сроке при подтверждении фетоплацентарной недостаточности проводится кесарево сечение. Операция необходима для спасения жизни будущего малыша. При гиперплазии других органов возможны сбои в их работе.

Что можете сделать вы

Самостоятельно определить диагноз гиперплазии в период беременности нельзя. Тем более когда речь идёт о патологическом процессе в тканях плаценты. После необходимых обследований следует придерживаться рекомендаций врача. Чтобы беременность проходила без осложнений, будущая мама должна состоять на учёте в женской консультации и регулярно проходить обследования.

Что делает врач

Лечение гиперплазии при беременности направлено на создание благоприятных условий для развития будущего малыша. Имеет значение причина возникновения патологического процесса разрастания тканей. Врач может назначить противомикробные препараты. В некоторых случаях, если наблюдается несовместимость крови мамы и ребёнка, приходится искусственно прерывать беременность. Но врач может назначить процедуру по переливанию крови через артерию пуповины. Чтобы повысить гемоглобин в крови будущей мамы, необходимо не только придерживаться правильного питания, но и принимать железосодержащие препараты. Для улучшения кровообращения также принимаются специальные лекарственные средства. Назначить необходимые медикаменты может только врач после обследования и постановки точного диагноза.

Для того чтобы предотвратить гиперплазию при беременности, необходимо знать причину этого патологического процесса. Если есть склонность к возникновению анемии, необходимо соблюдать меры по повышению гемоглобина в крови. Будущей маме необходимо придерживаться правильного и полноценного питания. По необходимости следует принимать витаминные комплексы, которые должен назначить врач. Специалисты советуют планировать беременность и проходить предварительно обследование. Это поможет вовремя устранить имеющиеся проблемы со здоровьем, чтобы беременность протекала без осложнений и тяжёлых последствий.

Вооружайтесь знаниями и читайте полезную информативную статью о заболевании гиперплазия при беременности. Ведь быть родителями – значит, изучать всё то, что поможет сохранять градус здоровья в семье на отметке «36,6».

Узнайте, что может вызвать недуг гиперплазия при беременности, как его своевременно распознать. Найдите информацию о том, каковы признаки, по которым можно определить недомогание. И какие анализы помогут выявить болезнь и поставить верный диагноз.

В статье вы прочтёте всё о методах лечения такого заболевания, как гиперплазия при беременности. Уточните, какой должна быть эффективная первая помощь. Чем лечить: выбрать лекарственные препараты или народные методы?

Также вы узнаете, чем может быть опасно несвоевременное лечение недуга гиперплазия при беременности, и почему так важно избежать последствий. Всё о том, как предупредить гиперплазия при беременности и не допустить осложнений. Будьте здоровы!

Патология плаценты, вызванная вирусом Зика: вирусная инфекция плаценты вызывает пролиферацию и гиперплазию стромальных макрофагов ворсинок (клетки Хофбауэра)

Контекст.— Плацента является важным компонентом в понимании реакции плода на внутриутробную инфекцию, вызванную вирусом Зика, но патологические изменения в этом органе остаются в значительной степени неизвестными. Клетки Хофбауэра представляют собой макрофаги эмбрионального происхождения, обычно присутствующие в строме ворсинок хориона.Они вовлечены в различные физиологические и патологические процессы, в частности, с участием инфекционных агентов.

Цели — Охарактеризовать реакции плода и матери и локализацию вируса в плаценте после передачи вируса Зика плоду на сроке гестации 11 недель. Клиническое течение отличалось длительной виремией у матери и обширным некрозом нейронов у плода. Плод родился на 21 неделе беременности после прерывания беременности.

Дизайн.— Плаценту оценивали с помощью иммуногистохимии на воспалительные клетки (макрофаги / моноциты [клетки Хофбауэра], В- и Т-лимфоциты) и пролиферирующие клетки, а также с помощью зонда РНК на вирус Зика. Ранее было обнаружено, что мозг плода и плацента являются положительными по РНК вируса Зика с помощью полимеразной цепной реакции с обратной транскрипцией.

Результаты.— Плацента продемонстрировала заметно увеличенные водные ворсинки хориона с гиперплазией и очаговой пролиферацией клеток Хофбауэра.Степень гиперплазии клеток Хофбауэра придавала ворсинкам преувеличенный незрелый вид. Острого или хронического виллита, некроза ворсинок, отдаленных некровоспалительных аномалий, хориоамнионита, фунизита или кровоизлияний не было. РНК-зонд на вирус Зика оказался положительным в клетках стромы ворсинок, предположительно в клетках Хофбауэра.

Выводы.— Плацентарная инфекция, вызванная вирусом Зика, вызывает пролиферацию и выраженную гиперплазию клеток Хофбауэра в ворсинах хориона, но не вызывает некроз ворсинок, лимфоплазмато-клеточную реакцию матери или плода или острую воспалительную клеточную реакцию.

Подтверждено, что инфекция, вызванная вирусом Зика, является причиной порока развития плода. 1 — беспрецедентный случай для инфекции, передаваемой членистоногими. Спектр заболеваний, вызываемых вирусом Зика среди взрослых и детей, все еще изучается и определяется, но из последней эпидемии в Южной и Центральной Америке, Мексике и на Карибских островах стало ясно, что при заражении беременных женщин появляются зародыши. подвергаться повышенному риску неблагоприятного клинического исхода. 2–9 Наиболее значительным воздействием вируса Зика на плод является возникновение нейронального некроза и микроцефалии — это было продемонстрировано в исследованиях нейровизуализации, проводимых как до родов, так и после рождения инфицированных младенцев. 2,3,7 Патологические исследования показали, что они являются важным компонентом исследования общественного здравоохранения возникающих инфекций, способствуя пониманию механизмов повреждения тканей, например, вируса иммунодефицита человека, вируса Эбола, хантавируса, Западного Вирус Нила и многие другие. 10–13 В тех ситуациях, когда инфекции могут передаваться от беременных женщин к их плоду, патология плаценты может предоставить важную информацию о механизме (ах) передачи от матери к плоду (вертикальной), природе воспалительной реакции от матери и плода к инфекции, а также от воздействия микроорганизмов на плаценту, такого как некроз, кровотечение или сосудистое заболевание. 14 В этом отчете подробно описываются микроскопические изменения в плаценте плода на сроке 21 недели беременности, мать которого заразилась симптоматической инфекцией вируса Зика на сроке беременности 11 недель. 15

История болезни матери и младенца была описана ранее. 15 Таким образом, у 33-летней беременной женщины развилась симптоматическая инфекция, вызванная вирусом Зика, после ее возвращения из путешествия по Центральной Америке. Ее укусили комары на сроке гестации 11 недель, и впоследствии на 12 неделе беременности у нее развились легкая лихорадка, миалгия, сыпь и боль в глазах. Четыре недели спустя ее сыворотка была положительной на иммуноглобулин (Ig) G и антитела IgM к вирусу Зика.Вложенная полимеразная цепная реакция обратной транскрипции (ОТ-ПЦР), проведенная на 16 неделе беременности, подтвердила наличие вируса Зика в ее сыворотке. Центры США по контролю и профилактике заболеваний в Атланте подтвердили материнскую вирусную инфекцию Зика с положительной сывороткой на IgM Зика более 1: 2560, используя тест нейтрализации уменьшения бляшек на 17 неделе беременности. Между 16-й и 20-й неделями беременности ультразвуковое исследование показало уменьшение окружности головы плода с 47-го до 24-го перцентиля.Ультразвуковое исследование плода на сроке 19 недель показало аномальную внутричерепную анатомию. После этого магнитно-резонансная томография плода на 20 неделе беременности показала более серьезные аномалии головного мозга, в том числе диффузную атрофию церебральной мантии, отсутствие нормальных паттернов расслоения мантии головного мозга, короткое мозолистое тело и умеренное увеличение третьего тела. и боковые желудочки. За день до планового прерывания беременности на 21 неделе беременности было обнаружено, что у матери все еще была положительная сыворотка на РНК вируса Зика с низким числом вирусов (21.1 × 10 3 копий / мл). Амниотическая жидкость также была положительной на РНК вируса Зика во время прерывания беременности. После родов было выполнено вскрытие плода, которое показало диффузное истончение коры головного мозга с обширным апоптозом постмиграционных нейронов неокортекса, микроминерализацией, заметной потерей объема белого вещества и субвентрикулярной зоны, разрежением аксонов и инфильтрацией макрофагов. Вирусные частицы были обнаружены с помощью электронной микроскопии, а высокие количества вирусной РНК Зика были обнаружены с помощью ОТ-ПЦР. 15 Плацента сдана на патологическое исследование. Существенная вирусная нагрузка вируса Зика была выявлена ​​в плаценте, экстраплацентарных мембранах и пуповине с помощью количественной ОТ-ПЦР.

Микроскопическое исследование плацентарного диска с использованием стандартного окрашивания гематоксилин-эозином выявило вторичные и третичные ворсинки хориона, которые были увеличены даже на 21 неделе беременности, с фокально выраженным отеком стромы (рис. 1, от A до C).Некоторые из увеличенных и отечных ворсинок имели неправильные очертания. Большинство ворсинок хориона на всех уровнях демонстрировали выраженную гиперцеллюлярность стромы ворсинок. Эти стромальные клетки имели различный вид, от округлых до веретеновидных, и имели морфологические черты ворсинчатых стромальных макрофагов (клетки Хофбауэра). Некоторые из клеток Хофбауэра содержали прозрачные внутрицитоплазматические вакуоли. Признаков продолжающегося или отдаленного острого или хронического виллита или интервиллозита не наблюдалось. Очаговый и умеренный внутрисосудистый кариорексис присутствовал в некоторых сосудах ворсинок хориона, что мы приписали недавно индуцированной внутриутробной гибели плода. 16 Нет некроза ворсинок, отдаленных некровоспалительных аномалий, репаративных изменений или фиброза ворсинок. Пуповина и экстраплацентарные оболочки были нормальными для гестационного возраста — фунизита и хориоамнионита не было. Никаких значительных кровоизлияний, острых или отдаленных, не было ни в одной из тканей плаценты. Никаких аномалий трофобласта не обнаружено.

Рисунок 1.

A – C, плацента с увеличенными отечными ворсинками хориона и гиперклеточной стромой, возникшие в результате пролиферации клеток Хофбауэра. Как видно на (C), некоторые из клеток Хофбауэра напоминают плазматические клетки. Обратите внимание на отсутствие ворсинок или некроза ворсинок (гематоксилин-эозин, исходное увеличение × 20 [A], × 100 [B] и × 400 [C]) .

Рисунок 1.

A – C, плацента с увеличенными отечными ворсинками хориона и гиперклеточной стромой в результате пролиферации клеток Хофбауэра.Как видно на (C), некоторые из клеток Хофбауэра напоминают плазматические клетки. Обратите внимание на отсутствие ворсинок или некроза ворсинок (гематоксилин-эозин, исходное увеличение × 20 [A], × 100 [B] и × 400 [C]) .

Иммуноокрашивание

CD163 и CD68 продемонстрировало интенсивно положительное окрашивание в гиперпластической популяции стромальных клеток как вторичных, так и третичных ворсинок, подтверждая их идентичность как стромальных макрофагов или клеток Хофбауэра.CD163 подчеркивал интенсивность гиперплазии клеток Хофбауэра — в некоторых ворсинах макрофаги были плотно упакованы и сливались (рис. 2, от A до F). Было очевидно, что увеличение ворсинок было связано не только с отеком, но и с гиперплазией клеток Хофбауэра, которая также внесла значительный вклад в больший, чем ожидалось, размер ворсинок хориона. Ki-67 продемонстрировал положительное внутриядерное окрашивание в случайных стромальных макрофагах (рис. 3, A и B), что соответствовало присутствию гиперпластической популяции клеток Хофбауэра.Некоторые клетки цитотрофобласта также экспрессировали окраску Ki-67, что было ожидаемо. Окрашивание лимфоцитов и плазматических клеток подтвердило впечатление об отсутствии виллита.

Рисунок 2.

Гиперплазия клеток Хофбауэра. А и В, окрашивание CD163 выявляет заметно увеличенное количество клеток Хофбауэра, присутствующих в строме всех ворсинок. C, клетки Хофбауэра плотно упакованы и сливаются в строме этой окрашенной CD163 третичной ворсинки хориона.Окрашивание D, CD68 выявляет характерный макрофагальный вид клеток Хофбауэра. E и F, окрашивание CD163 показывает, что гиперпластическая популяция клеток Хофбауэра простирается от непосредственно прилегающей к зоне базальной мембраны трофобласта в ядро ​​ворсинки и вокруг капилляров ворсинок (исходное увеличение × 40 [A], × 100 [B], × 200 [C] и × 400 [D, E и F]) .

Рисунок 2.

Гиперплазия клеток Хофбауэра. А и В, окрашивание CD163 выявляет заметно увеличенное количество клеток Хофбауэра, присутствующих в строме всех ворсинок.C, клетки Хофбауэра плотно упакованы и сливаются в строме этой окрашенной CD163 третичной ворсинки хориона. Окрашивание D, CD68 выявляет характерный макрофагальный вид клеток Хофбауэра. E и F, окрашивание CD163 показывает, что гиперпластическая популяция клеток Хофбауэра простирается от непосредственно прилегающей к зоне базальной мембраны трофобласта в ядро ​​ворсинки и вокруг капилляров ворсинок (исходное увеличение × 40 [A], × 100 [B], × 200 [C] и × 400 [D, E и F]) .

Рисунок 3.

A и B, антитела Ki-67, демонстрирующие сильную положительность в ядрах некоторых стромальных клеток Гофбауэра и в цитотрофобластах (исходное увеличение × 200 [A и B]) .

Рисунок 4. Редкие внутриворсинчатые стромальные клетки, предположительно клетки Хофбауэра, положительны в отношении РНК вируса Зика (красная стрелка). Положительный контроль с использованием пораженной паренхимы головного мозга (РНКскоп × 40, вставка × 100) .

Рисунок 3.

A и B, антитела Ki-67, демонстрирующие сильную положительность в ядрах некоторых стромальных клеток Гофбауэра и в цитотрофобластах (исходное увеличение × 200 [A и B]) .

Рисунок 4. Редкие внутриворсинчатые стромальные клетки, предположительно клетки Хофбауэра, положительны в отношении РНК вируса Зика (красная стрелка). Положительный контроль с использованием пораженной паренхимы головного мозга (РНКскоп × 40, вставка × 100) .

Гибридизация in situ с использованием РНК-зонда вируса Зика продемонстрировала рассеянные, сильно положительные окрашивающие клетки внутри ворсинчатой ​​стромы ворсинок хориона (рис. 4), которые предположительно были клетками Хофбауэра.

Наряду с эпидемиологическими, клиническими и радиологическими исследованиями, патологические исследования аутопсии внесли значительный вклад в согласованный вывод о том, что вирус Зика может вызывать деструктивные поражения головного мозга плода и микроцефалию. 15,17–23 В настоящее время не остается сомнений в том, что вирус Зика может достигать плаценты во время материнской виремии, передаваться развивающемуся плоду и вызывать повреждение головного мозга, микроцефалию, другие пороки развития (врожденный синдром Зика) и, в некоторых случаях, , перинатальная смерть.Во всех опубликованных вскрытиях плодов и новорожденных с микроцефалией от матерей с клиническим подозрением или подтверждением наличия инфекции вирусом Зика во время беременности вирус был идентифицирован в тканях мозга плода; он также был идентифицирован из других органов плода и околоплодных вод. 23–25 Исследования in vitro предоставили доказательства того, что вирус Зика обладает сродством к инфицированию клеток нервного происхождения. 26–28 Была разработана мышиная модель врожденной передачи вируса Зика, которая продемонстрировала гибель плода, повреждение мозга и присутствие вируса Зика в трофобласте, что соответствует трансплацентарной инфекции. 29 Однако плацента мыши является хориоаллантоидной, что затрудняет экстраполяцию этих результатов на гемомонохориальную плаценту человека.

Из-за серьезности патологических данных вскрытия центральной нервной системы плода, в данном случае плацентарные данные об отсутствии некроза или воспаления были неожиданными. Не было никаких доказательств продолжающегося, отдаленного, острого или хронического виллита или интервиллозита ни при обычном гистологическом окрашивании, ни при использовании антител к нейтрофилам, лимфоцитам и плазматическим клеткам.Виллит обычно присутствует при большинстве инфекций, передающихся через кровь матери, которые передаются вертикально, включая инфекции протозойными (болезнь Шагаса, токсоплазмоз), бактериальными ( Listeria , сифилис, грамотрицательные и грамположительные бактерии) и вирусными (краснуха). , цитомегаловирус) агентов. 30 В дополнение к возникновению воспалительной реакции в ворсинах хориона у матери или плода, которая может сопровождаться некрозом ворсинок, трансплацентарная передача этих агентов также вызывает воспаление и некроз клеток в соматических органах плода.Вирус Зика, по-видимому, отличается от некоторых агентов TORCH (таких как цитомегаловирус, Treponema pallidum [сифилис], Toxoplasma и вирус краснухи) и других гематогенно передаваемых инфекций, передаваемых от материнской системы кровообращения плода через плаценту. вызывает ряд патологий, деструктивных для тканей головного мозга плода, но не вызывает воспалительного лейкоцитарного ответа матери или плода в плаценте. Это свидетельствует о высокоселективной предрасположенности вируса к клеткам центральной нервной системы.

Наиболее поразительным наблюдением в плаценте была выраженная диффузная гиперплазия клеток Хофбауэра. Эти клетки имеют моноцитарное происхождение и вместе с фибробластами являются нормальным компонентом стромы ворсинок хориона. Клетки Хофбауэра имеют фетальное происхождение и впервые появляются в ворсинах хориона на 10-18-м днях беременности. Поскольку это предшествует развитию кровообращения плода, считается, что они изначально имеют мезенхимальное происхождение плода, происходящие из клеток-предшественников моноцитов желточного мешка, происходящего из гипобласта, которые мигрировали в мезенхимальное ядро ​​ворсинок.Было высказано предположение, что на более поздних сроках беременности они происходят из популяции привлеченных фетальных моноцитов. 31,32 Клетки Хофбауэра обладают многими гистологическими особенностями макрофагов в других органах — они представляют собой большие (10-30 мкм в диаметре) клетки с цитоплазматическими отростками и содержат большие вакуоли, пиноцитотические пузырьки и интрацитоплазматические гранулы. Они были охарактеризованы как M2 / альтернативно активированные макрофаги, 33 , и их функция включает фагоцитоз жидкостей и апоптотических материалов, презентацию антигена в ответ на инфекционные агенты и, возможно, ангиогенную роль в раннем васкулогенезе плаценты, поддержание водного баланса плаценты и эндокринная функция.Поскольку клетки Хофбауэра могут различаться по размеру и форме, их легко спутать с мононуклеарными воспалительными клетками, особенно с плазматическими клетками, что приводит к ошибочному диагнозу хронического лимфоцитарного или плазмоклеточного виллита (рис. 1, C). В плаценте от нормальных беременностей количество клеток Хофбауэра уменьшается к четвертому-пятому месяцу беременности, и для их визуализации может потребоваться иммуногистохимия с использованием антител к макрофагам / моноцитам. 31,32,34 Гиперплазия клеток Хофбауэра является ненормальной и, как сообщается, возникает в результате широкого спектра патологических состояний беременности.К ним относятся восходящие инфекции, 35 виллит неизвестной этиологии, 36 и инфекции, передающиеся через кровь матери, которые вызывают виллиты, включая TORCH-инфекции, такие как сифилис и цитомегаловирусная инфекция, 37,38 и болезнь Шагаса. 39 Механизм (ы), с помощью которого возникает гиперплазия клеток Хофбауэра в ответ на побуждающий фактор, является, по крайней мере частично, результатом пролиферации этих клеток в строме ворсинок хориона. Было обнаружено, что клетки Хофбауэра содержат фигуры митоза. 40 Способность клеток Хофбауэра пролиферировать в строме ворсинок хориона была подтверждена с помощью антител к маркерам клеточной пролиферации, таким как Ki-67. 41,42

В данном случае симптоматическая инфекция у матери началась на 11 неделе беременности при посещении эндемичного по вирусу Зика района, после чего было подтверждено наличие инфекции вируса Зика у матери как с помощью серологических методов, так и методов ОТ-ПЦР.Ее сыворотка оставалась положительной на РНК вируса Зика до дня до прерывания беременности на 21 неделе беременности. 15 Представляется очевидным, что в течение приблизительно 10-недельного периода от начальной симптоматики и продолжительности материнской виремии до гибели плода произошла трансплацентарная передача вируса Зика к плоду, что привело к активации, индукции пролиферации и, в конечном итоге, , заметно гиперпластическая популяция клеток Хофбауэра. Можно предположить, что эта плацентарная реакция началась вскоре (а не позже) после начала материнской инфекции и виремии.Это основано на акушерских ультразвуковых доказательствах начального снижения относительного процентиля роста головы плода, зарегистрированного на 16 неделе беременности, и степени гиперплазии клеток Хофбауэра в ворсинах хориона с относительно небольшим количеством стромальных макрофагов в пролиферативной стадии клетки. цикл ко времени родов плода и плаценты.

Мы продемонстрировали, что через 9 недель после начальной материнской симптоматики и продолжительной материнской виремии в плаценте все еще присутствовал обнаруживаемый вирус Зика в стромальных (Хофбауэровских) клетках ворсин хориона вместе с гиперплазией клеток Хофбауэра.Значение возникновения пролиферации и гиперплазии клеток Хофбауэра, вместе с демонстрацией остаточного вируса в этих стромальных клетках после трансплацентарной инфекции плода, особенно интересно в свете недавнего исследования, которое продемонстрировало, что вирус Зика может экспериментально инфицировать и впоследствии реплицироваться in, человеческие клетки Хофбауэра. В этом исследовании Quicke et al. 43 обнаружили, что клетки Хофбауэра, выделенные из плаценты доношенного человека, допускают заражение современным штаммом вируса Зика, который в настоящее время циркулирует в Северной и Южной Америке.После инфицирования in vitro клеток Хофбауэра вирусом Зика в этих клетках была зарегистрирована вирусная репликация, которая сопровождалась индукцией интерферона I типа и провоспалительных цитокинов. Вирусная инфекция также привела к умеренной активации клеток Хофбауэра, в которых наблюдалась повышающая регуляция транскрипции рецептора, индуцибельного гена I (RIG-I), подобного рецептору ретиноевой кислоты, а также последующих антивирусных эффекторных генов, что указывает на то, что инфицирование вирусом Зика клеток Хофбауэра индуцировало противовирусный ответ.Вывод этих исследователей о том, что заражение in vitro и репликация вируса Зика приводили к минимальному клеточному некрозу, особенно интересен из-за наших выводов об отсутствии недавнего или отдаленного некроза ворсин хориона плаценты инфицированного плода в этом отчете. Также важным в свете наших результатов является недавний отчет Мартинеса и его коллег 44 , которые описывают иммуногистохимическую идентификацию антигенов вируса Зика в клетках Хофбауэра ворсин хориона из плаценты плода, который был спонтанно выкидыш на 11 неделе беременности.

До сих пор не совсем понятно, какую роль (и) играет клетка Хофбауэра в облегчении или ингибировании трансплацентарной передачи инфекционных агентов, таких как вирус Зика. Однако на основе демонстрации в этой связи пролиферации и выраженной гиперплазии клеток Хофбауэра в плаценте от микроцефального плода, инфицированного на ранних сроках беременности, идентификации остаточного вируса Зика в стромальных клетках ворсинок с использованием зонда РНК и ранее опубликованных результатов Из-за инфекции in vitro и репликации вируса Зика в клетках Хофбауэра человека весьма вероятно, что клетка Хофбауэра играет важную или даже основную роль в тех случаях, когда действительно происходит трансплацентарная передача вируса Зика.Неожиданное отсутствие в тканях плаценты какого-либо некроза или лейкоцитарной реакции матери или плода на трансплацентарную вирусную инфекцию Зика также интересно и имеет неизвестное значение.

Человеческий плацентарный лактоген — обзор

Человеческий плацентарный лактоген

Также называемый хорионическим соматомаммотропином, hPL представляет собой одноцепочечный негликозилированный полипептид, состоящий из 191 аминокислотного остатка и двух дисульфидных мостиков с молекулярной массой 21 600 Да. 46 Он тесно связан химически и биологически как с GH (85% гомологии аминокислот), так и с пролактином (гомология аминокислот 13%). Кластер генов hGH-hPL расположен на длинном плече хромосомы 17 и состоит из пяти генов: один кодирует hGH-N, один — hGH-V и три — плацентарный hPL (hPL-L, hPL-A и hPL. -B, из которых транскрибируются только hPL-A и hPL-B). 116

hPL синтезируется и секретируется синцитиотрофобластом и обнаруживается в материнской сыворотке между 20 и 40 днями беременности.Уровни материнской сыворотки быстро растут и достигают пика на 34 неделе, после чего следует плато 46 (рис. 21-5). Как сывороточные концентрации, так и концентрации мРНК hPL в плаценте тесно коррелируют с массой плаценты и синцитиотрофобластной массой. 117 Концентрации материнской сыворотки в среднем от 6 до 7 мкг / мл; в это время, на основании 9-15-минутного исчезновения из кровообращения, скорость продуцирования hPL через плаценту превышает 1 г / день. Уровни сыворотки плода должны соответствовать уровню матери. 116

Физиологическая регуляция синтеза и секреции hPL in vivo, кроме конститутивной продукции, связанной с массой плаценты, неизвестна. В нескольких исследованиях изучалась возможная роль питательных веществ в секреции hPL у беременных женщин. Ни острая гипергликемия, ни гипогликемия не повлияли на концентрацию hPL, хотя длительные инфузии глюкозы снижали, а длительное голодание увеличивало концентрации. 46,95 Инфузии аргинина, введение дексаметазона и изменения уровней свободных жирных кислот в плазме не влияли на концентрацию hPL у матери. 118,119 Глюкоза, эстрогены, глюкокортикоиды, простагландины, адреналин, окситоцин, TRH, GnRH и l-dopa были исследованы в системах in vitro и не показали стойких эффектов. 120-123

Ангиотензин II, IGF-1, фосфолипаза A 2 , арахидоновая кислота и эпидермальный фактор роста стимулировали высвобождение hPL in vitro. 95,124 Эпидермальный фактор роста, вероятно, усиливает продукцию за счет стимулирования дифференцировки цитотрофобластов в синцитиотрофобласты. 124 Аполипопротеин AI также стимулировал синтез и высвобождение hPL посредством цАМФ-зависимых и зависимых от арахидоновой кислоты путей. 46,125,126 Поскольку изменения в концентрациях аполипопротеина AI в плазме матери параллельны изменениям концентрации hPL во время беременности, вполне вероятно, что этот апопротеин, сам по себе и как часть циркулирующего HDL, важен для секреции hPL. 126

hPL обладает рядом биологических активностей, которые качественно аналогичны активностям hGH и пролактина, и могут связываться как с рецепторами hGH, так и с рецепторами пролактина. 127 В различных системах биотестирования hPL оказывал слабые соматотропные и лактогенные эффекты. 127,128 По-видимому, он является основным регулятором продукции IGF-1, и во время беременности концентрации hPL коррелируют с концентрациями IGF-1. 46,128 HPL также влияет на метаболизм питательных веществ матери. Он стимулирует секрецию инсулина островками поджелудочной железы как непосредственно, так и после приема углеводов, 127 и является диабетогенным фактором во время беременности, способствуя развитию инсулинорезистентности.Он усиливает липолиз, что приводит к увеличению количества свободных жирных кислот, которые частично могут быть причиной инсулинорезистентности. 127

Различные биологические активности hPL привели к гипотезе о том, что роль hPL во время беременности заключается в обеспечении плода постоянным запасом глюкозы и аминокислот. 127 Липолиз, стимулированный hPL, позволяет матери использовать свободные жирные кислоты для получения энергии во время голодания, позволяя глюкозе, аминокислотам и кетоновым телам проходить через плаценту для использования плодом.Кроме того, hPL оказывает действие на плод, способствуя поглощению аминокислот мышцами и стимулируя выработку белка, выработку IGF-1 и синтез гликогена. 128

Несмотря на предполагаемую важность hPL в метаболическом гомеостазе матери и плода во время беременности, его отсутствие, по-видимому, не влияет на беременность. Недостаточная или отсутствующая продукция hPL, связанная с дефектами генов, была описана у нескольких женщин, перенесших нормальную беременность и родивших нормальных детей. 129

Патология плаценты в третьем триместре беременных от COVID-19 | Диагностическая патология

  • 1.

    Хуанг Ц., Ван И, Ли Х и др. Клинические особенности пациентов, инфицированных новым коронавирусом 2019 г., в Ухане, Китай. Ланцет. 2020; 395: 497–506.

    CAS PubMed PubMed Central Google ученый

  • 2.

    Чжу Н., Чжан Д., Ван В. и др. Новый коронавирус от пациентов с пневмонией в Китае, 2019. N Engl J Med. 2020; 382: 727–33.

    CAS PubMed PubMed Central Google ученый

  • 3.

    Zhou F, Yu T, Du R, et al. Клиническое течение и факторы риска смертности взрослых стационарных пациентов с covid-19 в Ухане, Китай: ретроспективное когортное исследование. Ланцет. 2020; 395: 1054–62.

    CAS PubMed PubMed Central Google ученый

  • 4.

    Guan WJ, Ni ZY, Hu Y и др. Клиническая характеристика коронавирусной болезни 2019 г. в Китае. N Engl J Med. 2020; 382: 1708–20.

    CAS PubMed Google ученый

  • 5.

    Мор Г., Карденас И. Иммунная система во время беременности: уникальная сложность. Am J Reprod Immunol. 2010. 63: 425–33.

    CAS PubMed PubMed Central Google ученый

  • 6.

    Goodnight WH, Soper DE. Пневмония при беременности. Crit Care Med. 2005; 33: S390–7.

    PubMed Google ученый

  • 7.

    Лю Х., Ван Л.Л., Чжао С.Дж., Квак-Ким Дж., Мор Дж., Ляо А.Х. Почему беременные женщины восприимчивы к COVID-19? Иммунологическая точка зрения.J Reprod Immunol. 2020; 139: 103122.

    CAS PubMed PubMed Central Google ученый

  • 8.

    Альфарадж С.Х., Аль-Тауфик Дж.А., Мемиш З.А. Инфекция, вызванная коронавирусом (mers-cov) ближневосточного респираторного синдрома во время беременности: отчет о двух случаях и обзор литературы. J Microbiol Immunol Infect. 2019; 52: 501–3.

    PubMed Google ученый

  • 9.

    Вонг С.Ф., Чоу К.М., Леунг Т.Н. и др.Беременность и перинатальные исходы женщин с тяжелым острым респираторным синдромом. Am J Obstet Gynecol. 2004; 191: 292–7.

    PubMed PubMed Central Google ученый

  • 10.

    Schwartz DA, Graham AL. Возможные исходы заражения беременных женщин коронавирусом (Ухань) 2019-ncov для матери и ребенка: уроки sars, mers и других коронавирусных инфекций человека. Вирусы. 2020; 12.

  • 11.

    Шварц Д.А., Даливал А.Инфекции во время беременности, вызванные covid-19 и другими респираторными РНК-вирусными заболеваниями, редко, если вообще когда-либо, передаются плоду: опыт с коронавирусами, HPIV, hmpv rsv и гриппом. Arch Pathol Lab Med. 2020.

  • 12.

    Кирцман М., Диамбомба Й., Поутанен С.М. и др. Вероятная врожденная инфекция sars-cov-2 у новорожденного, рожденного от женщины с активной инфекцией sars-cov-2. CMAJ. 2020; 192: E647–50.

    CAS PubMed PubMed Central Google ученый

  • 13.

    Patane L, Morotti D, Giunta MR, et al. Вертикальная передача коронавирусной болезни 2019: тяжелый острый респираторный синдром коронавируса 2 рнк на фетальной стороне плаценты у беременных с коронавирусной болезнью 2019-положительных матерей и новорожденных при рождении. Am J Obstet Gynecol MFM. 2020; 2: 100145.

    PubMed PubMed Central Google ученый

  • 14.

    Сисман Дж., Джалил М.А., Морено В. и др. Внутриутробная передача инфекции sars-cov-2 у недоношенного ребенка.Pediatr Infect Dis J. 2020; 39: e265–7.

    PubMed Google ученый

  • 15.

    Виванти А.Дж., Ваулоуп-Феллоус С., Превот С. и др. Трансплацентарная передача инфекции sars-cov-2. Nat Commun. 2020; 11: 3572.

    CAS PubMed PubMed Central Google ученый

  • 16.

    Арора Н., Садовский Ю., Дермоди Т.С., Койн CB. Вертикальная передача микробов во время беременности человека.Клеточный микроб-хозяин. 2017; 21: 561–7.

    CAS PubMed PubMed Central Google ученый

  • 17.

    Факкетти Ф, Бугатти М, Дрера Э и др. Вертикальная передача Sars-cov2 с неблагоприятным воздействием на новорожденных, выявленная с помощью комплексных иммуногистохимических исследований, электронной микроскопии и молекулярного анализа плаценты. EBioMedicine. 2020; 59: 102951.

    PubMed PubMed Central Google ученый

  • 18.

    Хосиер Х., Фархадиан С.Ф., Моротти Р.А. и др. Заражение плаценты Sars-cov-2. J Clin Invest. 2020; 130 (9): 4947–53.

  • 19.

    Шварц Д.А., Моротти Д. Плацентарная патология covid-19 с внутриутробной и неонатальной инфекцией и без нее: некроз трофобластов и хронический гистиоцитарный интервиллозит как факторы риска трансплацентарной передачи sars-cov-2. Вирусы. 2020; 12 (2): 194.

  • 20.

    Schwartz DA, Morotti D, Beigi B, Moshfegh F, Zafaranloo N, Patane L.Подтверждение вертикального инфицирования плода коронавирусной болезнью 2019: критерии неонатальности и патологии для раннего начала и трансплацентарной передачи тяжелого острого респираторного синдрома коронавируса 2 от инфицированных беременных матерей. Arch Pathol Lab Med. 2020; 144: 1451–6.

    PubMed Google ученый

  • 21.

    Heerema-McKenney A. Защита и инфекция плаценты человека. APMIS. 2018; 126: 570–88.

    PubMed Google ученый

  • 22.

    Rosenberg AZ, Yu W., Hill DA, Reyes CA, Schwartz DA. Плацентарная патология вируса Зика: вирусная инфекция плаценты вызывает пролиферацию и гиперплазию ворсинчатых стромальных макрофагов (клеток Хофбауэра). Arch Pathol Lab Med. 2017; 141: 43–8.

    PubMed Google ученый

  • 23.

    Байер А., Делорм-Аксфорд Э., Слейгер С. и др. Человеческие трофобласты придают устойчивость к вирусам, вызывающим перинатальную инфекцию. Am J Obstet Gynecol.2015; 212: 71 e71–8.

    Google ученый

  • 24.

    Cardenas I, Means RE, Aldo P, et al. Вирусная инфекция плаценты приводит к воспалению плода и сенсибилизации к бактериальным продуктам, предрасполагающим к преждевременным родам. J Immunol. 2010; 185: 1248–57.

    CAS PubMed Google ученый

  • 25.

    Лю Ю.Л., Рен Дж., Юань Дж. П. и др. Послеоперационное начало и обнаружение sars-cov-2 в хирургически удаленных образцах от пациентов с раком желудочно-кишечного тракта с пре / бессимптомным covid-19.Ann Surg. 2020; 272: e321–8.

    PubMed Google ученый

  • 26.

    Коста М.Л., де Мораес Н.Г., Антолини-Таварес А. Основные инфекции плаценты. Obstet Gynecol Clin N Am. 2020; 47: 133–46.

    Google ученый

  • 27.

    Роббинс Дж. Р., Бакарджиев А. И.. Возбудители и плацентарная крепость. Curr Opin Microbiol. 2012; 15: 36–43.

    PubMed Google ученый

  • 28.

    Chen S, Huang B, Luo DJ и др. Беременные женщины с новой коронавирусной инфекцией: клиническая характеристика и плацентарный патологический анализ трех случаев. Чжунхуа Бин Ли Сюэ За Чжи. 2020; 49: E005.

    Google ученый

  • 29.

    Шейнс Э.Д., Митал Л.Б., Отеро С., Азад Х.А., Миллер Э.С., Гольдштейн Дж. Патология плаценты при covid-19. Am J Clin Pathol. 2020; 154: 23–32.

    CAS PubMed Google ученый

  • 30.

    Villegas-Castrejon H, Paredes-Vivas Y, Flores-Rivera E, Gorbea-Robles MC, Arredondo-Garcia JL. сравнительное исследование плаценты от ВИЧ + матери. Ультраструктурный анализ. Ginecol Obstet Mex. 1996. 64: 167–76.

    CAS PubMed Google ученый

  • 31.

    Шварц Д.А., Хан Р., Столл Б. Характеристика воспалительной реакции плода на цитомегаловирусный плацентит. Иммуногистохимическое исследование. Arch Pathol Lab Med. 1992; 116: 21–7.

    CAS PubMed Google ученый

  • 32.

    Рейес Л., Голос Т.Г. Клетки Хофбауэра: их роль в здоровой и осложненной беременности. Фронт Иммунол. 2018; 9: 2628.

    PubMed PubMed Central Google ученый

  • 33.

    Schwartz DA. Вирусная инфекция, пролиферация и гиперплазия клеток хофбауэра и отсутствие воспаления характеризуют патологию плаценты у плодов с врожденной инфекцией вируса Зика.Arch Gynecol Obstet. 2017; 295: 1361–8.

    PubMed PubMed Central Google ученый

  • 34.

    Schwartz DA. Анализ 38 беременных женщин с covid-19, их новорожденных детей и передачи sars-cov-2 от матери к плоду: инфекции коронавируса матери и исходы беременности. Arch Pathol Lab Med. 2020.

  • 35.

    Лангель С.Н., Пайм Ф.С., Альхамо М.А. и др. Стадия гестации при заражении вирусом эпидемической диареи свиней у беременных свиней влияет на материнский иммунитет и лактогенную иммунную защиту новорожденных поросят-сосунов.Фронт Иммунол. 2019; 10: 727.

    CAS PubMed PubMed Central Google ученый

  • 36.

    Bouthry E, Picone O, Hamdi G, Grangeot-Keros L, Ayoubi JM, Vauloup-Fellous C. Краснуха и беременность: диагностика, лечение и исходы. Prenat Diagn. 2014; 34: 1246–53.

    PubMed Google ученый

  • 37.

    Chen H, Guo J, Wang C, et al. Клинические характеристики и потенциал внутриутробной вертикальной передачи инфекции covid-19 у девяти беременных женщин: ретроспективный обзор медицинских карт.Ланцет. 2020; 395: 809–15.

    CAS PubMed PubMed Central Google ученый

  • 38.

    Карими-Зарчи М., Няматзаде Х., Дастгейб С.А. и др. Вертикальная передача коронавирусной болезни 19 (covid-19) от инфицированных беременных матерей новорожденным: обзор. Fetal Pediatr Pathol. 2020: 1–5.

  • 39.

    Майджи Э., Нигро Дж., Табата Т. и др. Лечение антителами способствует компенсации патогенеза, вызванного цитомегаловирусом человека, и состояния, подобного гипоксии, в плаценте с врожденной инфекцией.Am J Pathol. 2010. 177: 1298–310.

    CAS PubMed PubMed Central Google ученый

  • 40.

    Delorme-Axford E, Donker RB, Mouillet JF, et al. Плацентарные трофобласты человека придают реципиентным клеткам вирусную устойчивость. Proc Natl Acad Sci U S. A. 2013; 110: 12048–53.

    CAS PubMed PubMed Central Google ученый

  • 41.

    Bayer A, Lennemann NJ, Ouyang Y, et al.Интерфероны типа III, продуцируемые трофобластами плаценты человека, обеспечивают защиту от заражения вирусом Зика. Клеточный микроб-хозяин. 2016; 19: 705–12.

    CAS PubMed PubMed Central Google ученый

  • 42.

    Шеридан М.А., Юнусов Д., Балараман В. и др. Уязвимость примитивного трофобласта плаценты человека к вирусу Зика. Proc Natl Acad Sci U S. A. 2017; 114: E1587–96.

    CAS PubMed PubMed Central Google ученый

  • 43.

    Фогарти Н.М., Фергюсон-Смит А.С., Бертон Дж. Дж. Синцитиальные узлы (изменения Тенни-Паркера) в плаценте человека: свидетельство потери транскрипционной активности и окислительного повреждения. Am J Pathol. 2013; 183: 144–52.

    PubMed Google ученый

  • 44.

    Loukeris K, Sela R, Baergen RN. Синцитиальные узлы как отражение зрелости плаценты: контрольные значения для гестационного возраста от 20 до 40 недель. Pediatr Dev Pathol. 2010; 13: 305–9.

    PubMed Google ученый

  • 45.

    Хизелл А.Е., Молл С.Дж., Джонс С.Дж., Бейкер П.Н., Крокер И.П. Образование синцитиальных узлов усиливается гипероксией, гипоксией и активными формами кислорода. Плацента. 2007; 28 (Приложение A): S33–40.

    PubMed Google ученый

  • 46.

    Ng WF, Wong SF, Lam A, et al. Плаценты больных тяжелым острым респираторным синдромом: патофизиологическая оценка. Патология. 2006; 38: 210–8.

    CAS PubMed Google ученый

  • 47.

    Penfield CA, Brubaker SG, Limaye MA, et al. Обнаружение sars-cov-2 в образцах мембран плаценты и плода. Am J Obstet Gynecol MFM. 2020; 100133.

  • 48.

    Baud D, Greub G, Favre G, et al. Выкидыш во втором триместре у беременной с инфекцией sars-cov-2. ДЖАМА. 2020; 323: 2198–200.

    CAS PubMed PubMed Central Google ученый

  • 49.

    Richtmann R, Torloni MR, Oyamada Otani AR, et al.Смертность плода при беременности с инфекцией sars-cov-2 в Бразилии: серия случаев. Case Rep Womens Health. 2020; 27: e00243.

    PubMed PubMed Central Google ученый

  • SARS-CoV-2 может инфицировать плаценту и не связан с конкретной гистопатологией плаценты: серия из 19 плацент от матерей, инфицированных COVID-19

  • 1.

    Zhu N, Zhang D, Wang W, Li X, Ян Б., Сонг Дж и др. Новый коронавирус от пациентов с пневмонией в Китае, 2019 год.N Engl J Med. 2020; 382: 727–33.

    CAS Статья Google ученый

  • 2.

    Hoffmann M, Kleine-Weber H, Schroeder S, Kruger N, Herrler T., Erichsen S, et al. Вход в клетки SARS-CoV-2 зависит от ACE2 и TMPRSS2 и блокируется клинически доказанным ингибитором протеазы. Клетка. 2020; 181: e8.

    Артикул Google ученый

  • 3.

    Маллинз Э., Эванс Д., Винер Р.М., О’Брайен П., Моррис Э.Коронавирус при беременности и родах: экспресс-обзор. Ультразвуковой акушерский гинекол. 2020; 55: 586–92.

    CAS Статья Google ученый

  • 4.

    Бод D, Greub G, Favre G, Gengler C, Jaton K, Dubruc E, et al. Выкидыш во втором триместре у беременной с инфекцией SARS-CoV-2. ДЖАМА. 2020. https://doi.org/10.1001/jama.2020.7233.

  • 5.

    Кирцман М., Диамбомба Ю., Поутанен С.М., Малиновски А.К., Влаходимитропулу Е., Паркс В.Т. и др.Вероятная врожденная инфекция SARS-CoV-2 у новорожденного, рожденного от женщины с активной инфекцией SARS-CoV-2. CMAJ. 2020; 192: E647–50.

    CAS Статья Google ученый

  • 6.

    Chen S, Huang B, Luo DJ, Li X, Yang F, Zhao Y, et al. [Беременные с новой коронавирусной инфекцией: клиническая характеристика и плацентарный патологический анализ трех случаев]. Чжунхуа Бин Ли Сюэ За Чжи. 2020; 49: E005.

    Google ученый

  • 7.

    Лю Ю., Чен Х, Тан К., Го Ю. Клинические проявления и исход инфекции SARS-CoV-2 во время беременности. J Infect. 2020. https://doi.org/10.1016/j.inf.2020.02.028.

  • 8.

    Чжу Х., Ван Л., Фанг С., Пэн С., Чжан Л., Чанг Г. и др. Клинический анализ 10 новорожденных, рожденных от матерей с пневмонией 2019-nCoV. Перевод Педиатр. 2020; 9: 51–60.

    Артикул Google ученый

  • 9.

    Хосиер Х., Фархадиан Р., Моротти Р., Дешмук У., Лу-Каллиган А., Кэмпбелл К. и др.SARS-CoV-2 инфицирование плаценты. 2020. https://doi.org/10.1172/JCI139569.

  • 10.

    Patane L, Morotti D, Giunta MR, Sigismondi C, Piccoli MG, Frigerio L, et al. Вертикальная трансмиссия коронавирусной болезни 2019: РНК коронавируса 2 тяжелого острого респираторного синдрома на фетальной стороне плаценты у беременных с COVID-19-положительными матерями и новорожденными при рождении. AJOG MFM. 2020. https://doi.org/10.1016/j.ajogmf.2020.100145.

  • 11.

    Redline RW, Boyd TK, Roberts DJ, редакторы.Плацентарная и гестационная патология. Том 1. Кембридж, Великобритания: Cambridge University Place; 2018. с. 344.

  • 12.

    Parry S, Holder J, Strauss JF 3-й. Механизмы взаимодействия трофобласта с вирусом. J Reprod Immunol. 1997. 37: 25–34.

    CAS Статья Google ученый

  • 13.

    Koi H, Zhang J, Parry S. Механизмы плацентарной вирусной инфекции. Ann N Y Acad Sci. 2001; 943: 148–56.

    CAS Статья Google ученый

  • 14.

    Бэрген Р.Н., Хеллер Д.С. Патология плаценты у матерей с положительным результатом на Covid-19: предварительные данные. Pediatr Dev Pathol. 2020; 23: 177–80.

    Артикул Google ученый

  • 15.

    Шуо Ц., Бо Х, Данджу Л., Сян Л., Фан Й, Инь З и др. Клиническая характеристика и патологический анализ плаценты в трех случаях беременных с новой коронавирусной инфекцией. Чин Дж. Патол. 2020; 49: 418–23.

    Google ученый

  • 16.

    Shanes ED, Mithal LB, Otero S, Azad HA, Miller ES, Goldstein JA. Патология плаценты при COVID-19. Am J Clin Pathol. 2020; 154: 23–32.

    CAS Статья Google ученый

  • 17.

    Massoth LR, Desai N, Szabolcs A, Harris CK, Neyaz A, Crotty R, et al. Сравнение методов гибридизации РНК in-situ и иммуногистохимии для обнаружения и локализации SARS-CoV-2 в тканях человека. Am J Surg Pathol. 2020. В печати.

  • 18.

    Khong TY, Mooney EE, Ariel I, Balmus NC, Boyd TK, Brundler MA, et al. Отбор образцов и определение поражений плаценты: Согласованное заявление группы Амстердамского семинара по изучению плаценты. Arch Pathol Lab Med. 2016; 140: 698–713.

    Артикул Google ученый

  • 19.

    Аламар И., Хейман Т., Абу-Арджа М., Чжан П., Салафия С.М., Робертс Д.Д. и др. Положительная триада SARS-COV-2: мать, плацента и новорожденный. J Ped Infect Dis Soc.На рассмотрении.

  • 20.

    Эббинг К., Кисеруд Т., Йонсен С.Л., Альбрехтсен С., Расмуссен С. Распространенность, факторы риска и исходы имплантации веломицетов и маргинальных пуповин: популяционное исследование 634 741 беременности. PLoS ONE. 2013; 8: e70380.

    CAS Статья Google ученый

  • 21.

    Чатов Дж. М., Малдун М. Ф., Рейс С. Е., Несс Р. Б., Нгуен Л. Н., Ямал Дж. М. и др. Преждевременные роды с плацентарными признаками мальперфузии связаны с сердечно-сосудистыми факторами риска после беременности: проспективное когортное исследование.BJOG. 2017; 125: 1009–17.

    Артикул Google ученый

  • 22.

    Файе-Петерсен О.М., Эрнст Л.М. Инфаркт дна матери и массивное отложение фибрина в перивилле. Surg Pathol Clin. 2013; 6: 101–14.

    Артикул Google ученый

  • 23.

    Вик Т., Редлайн Р., Нельсон К.Б., Бьельмо С., Фогт С., Нг П. и др. Плацента при неонатальной энцефалопатии: исследование случай-контроль. J Pediatr.2018; 202: e3.

    Артикул Google ученый

  • 24.

    Bos M, Nikkels PGJ, Cohen D, Schoones JW, Bloemenkamp KWM, Bruijn JA, et al. К стандартизированным критериям диагностики хронического интервиллезита неизвестной этиологии: систематический обзор. Плацента. 2018; 61: 80–8.

    CAS Статья Google ученый

  • 25.

    Redline RW. Виллит неустановленной этиологии: хронический неинфекционный виллит в плаценте.Hum Pathol. 2007; 38: 1439–46.

    Артикул Google ученый

  • 26.

    Yu N, Li W, Kang Q, Xiong Z, Wang S, Lin X и др. Клинические особенности, акушерские и неонатальные исходы беременных с COVID-19 в Ухане, Китай: ретроспективное одноцентровое описательное исследование. Lancet Infect Dis. 2020; 20: 559–64.

    CAS Статья Google ученый

  • 27.

    Ян Дж., Го Дж., Фан Ц., Хуан Дж., Ю Икс, Ли Дж. И др.Коронавирусная болезнь 2019 (COVID-19) у беременных: отчет, основанный на 116 случаях. Am J Obstet Gynecol. 2020; 223: 111e1–14.

  • 28.

    Schwartz DA, Dhaliwal A. Инфекции во время беременности, вызванные covid-19 и другими респираторными РНК-вирусными заболеваниями, редко, если вообще когда-либо, передаются плоду: опыт с коронавирусами, HPIV, hMPV, RSV и гриппом A. Arch Pathol Lab Med. 2020. https://doi.org/10.5858/arpa.2020-0211-SA.

  • 29.

    Лю Д., Ли Л., Ву Х, Чжэн Д., Ван Дж., Ян Л. и др.Беременность и перинатальные исходы у женщин с пневмонией, вызванной коронавирусной болезнью (COVID-19): предварительный анализ. Am J Roentgenol. 2020; 215: 1–6.

  • 30.

    Dong L, Tian J, He S, Zhu C, Wang J, Liu C и др. Возможная вертикальная передача SARS-CoV-2 от инфицированной матери ее новорожденному. ДЖАМА. 2020. https://doi.org/10.1001/jama.2020.4621.

  • 31.

    Zeng H, Xu C, Fan J, Tang Y, Deng Q, Zhang W и др. Антитела у младенцев, рожденных от матерей с пневмонией COVID-19.ДЖАМА. 2020. https://doi.org/10.1001/jama.2020.4861.

  • 32.

    Пинар Х, Сунг СиДжей, Ойер С.Е., Зингер ДБ. Ориентировочные значения веса одиночной и двойной плаценты. Pediatr Pathol Lab Med. 1996; 16: 901–7.

    CAS Статья Google ученый

  • Инфекция вирусом Зика у иммунокомпетентных беременных мышей вызывает повреждение плода и патологию плаценты при отсутствии инфекции плода

    Abstract

    Инфекция вирусом Зика (ZIKV) во время беременности человека может вызывать разнообразные и серьезные врожденные дефекты у развивающегося плода.Предыдущие попытки создания животных моделей инфекции ZIKV человека и клинических симптомов часто включали манипуляции с мышами, чтобы нарушить их передачу сигналов интерферона I типа (IFN), что позволило усилить инфекцию и вертикальную передачу вируса эмбриону. Здесь мы показываем, что даже у беременных мышей, способных генерировать ответы IFN типа I, которые могут ограничивать инфекцию ZIKV, тем не менее развиваются глубокая патология плаценты и высокая частота гибели плода. Мы последовательно обнаружили, что воздействие ZIKV у матери приводило к патологии плаценты и что уровни РНК ZIKV, измеренные в тканях матери, плаценты или эмбриона, не позволяли прогнозировать патологические эффекты, наблюдаемые у эмбрионов.Патология плаценты включала гиперплазию трофобласта в лабиринте, некроз гигантских клеток трофобласта в зоне соединения и потерю эмбриональных сосудов. Наши результаты показывают, что в этом контексте ограниченной инфекции патология плаценты, а не вирусная инфекция эмбриона / плода, может быть более сильным фактором неблагоприятных исходов беременности у мышей. Наше открытие показывает, что у иммунокомпетентных мышей прямая вирусная инфекция эмбриона не является существенной причиной гибели плода. Наша иммунологически необработанная модель мышей во время беременности обеспечивает последовательные и легко поддающиеся измерению данные о врожденных аномалиях для оценки результатов для плода и может служить дополнительной моделью для тестирования профилактических и терапевтических вмешательств для защиты плода во время беременности, а также для изучения механизмов врожденного иммунопатогенеза ZIKV.

    Сведения об авторе

    Инфекция вируса Зика (ZIKV) во время беременности человека может вызвать серьезные врожденные аномалии и смерть плода. В настоящее время не существует лицензированной вакцины или терапевтического средства против ZIKV для предотвращения или лечения инфекции и / или заболевания. Чтобы создать модель на животных, которая имитирует инфекции ZIKV человека, другие манипулировали мышами, чтобы ослабить их врожденный иммунитет, что позволяет ZIKV развивать высокие уровни инфекции. Здесь мы представляем экспериментальную модель с использованием иммунологически необработанных беременных мышей и показываем, что даже ограниченная материнская инфекция ZIKV, тем не менее, привела к глубокой патологии плаценты и высокой частоте гибели плода.Однако ни один уровень вирусной РНК в матери, плаценте или эмбрионе не позволял достоверно прогнозировать аномалии плода. Наши исследования показывают, что в этой модели патология плаценты, включая гиперплазию трофобластов, очаговые области некроза и потерю эмбриональных кровеносных сосудов в плаценте, вероятно, способствует неблагоприятным исходам для плода. Эта иммунокомпетентная модель беременных мышей обеспечивает четкое считывание фенотипов in vivo и (например, жизнеспособность эмбриона, крупную морфологию матки и эмбриона) для оценки потенциальной клинической пользы вакцин-кандидатов и терапевтических средств в модели, не зависящей от вертикальной передачи вируса.

    Образец цитирования: Szaba FM, Tighe M, Kummer LW, Lanzer KG, Ward JM, Lanthier P, et al. (2018) Инфекция вируса Зика у иммунокомпетентных беременных мышей вызывает повреждение плода и патологию плаценты при отсутствии инфекции плода. PLoS Pathog 14 (4): e1006994. https://doi.org/10.1371/journal.ppat.1006994

    Редактор: Кэролин Б. Койн, Питтсбургский университет, США

    Поступила: 1 февраля 2018 г .; Принята к печати: 27 марта 2018 г .; Опубликован: 10 апреля 2018 г.

    Авторские права: © 2018 Szaba et al.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

    Доступность данных: Все соответствующие данные находятся в документе и его файлах с вспомогательной информацией.

    Финансирование: Эта работа финансировалась Институтом Трюдо. Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

    Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует. JMW — патолог и консультант веб-сайта Global VetPathology. Ни JMW, ни Global VetPathology не получают средств, грантов или контрактов от каких-либо финансовых агентств.

    Введение

    Вирус Зика (ZIKV) — это переносимый комарами вирус, принадлежащий к роду Flaviviridae, и он тесно связан с несколькими другими арбовирусами, включая вирусы денге (DENV), вирус желтой лихорадки (YFV), вирус Западного Нила (WNV), Вирус японского энцефалита (JEV) и вирус клещевого энцефалита (TBEV) [1].Инфекция ZIKV часто протекает бессимптомно или представляет собой легкое, самоограничивающееся лихорадочное заболевание, сопровождающееся сыпью, недомоганием, конъюнктивитом или болями в мышцах и суставах [1–3]. Эпидемия в Северной и Южной Америке, впервые отмеченная в 2015 году, была временно связана с возникновением тысяч аномалий плода во время беременности [1–4], и причинно-следственная связь между инфекцией ZIKV и неблагоприятными исходами беременности (например, врожденный синдром ZIKV, CZS) с тех пор была установлена. установлено как у людей, так и после экспериментального заражения беременных мышей и нечеловеческих приматов [4–13].CZS включает в себя ряд потенциальных аномалий, включая ограничение внутриутробного развития (IUGR), гибель плода, приводящую к самопроизвольному аборту, мертворождение, микроцефалию, глазные расстройства и аномалии развития, которые еще предстоит полностью охарактеризовать [14-17]. Из-за разрушительных последствий CZS, вакцины и меры противодействия лекарствам разрабатываются быстрыми темпами, и первоначальное внимание уделяется предотвращению инфекций и болезней у женщин детородного возраста.

    Доклинические модели беременности мышей были разработаны для изучения последствий инфекции ZIKV для развивающегося эмбриона / плода [6, 7, 18–23].Мышиные модели инфекции ZIKV ограничены неспособностью вируса реплицироваться и вызывать явные клинические симптомы и проявления болезни у иммунокомпетентных мышей. Было продемонстрировано, что ответ мыши на врожденный интерферон I типа (IFN) устраняет инфекцию ZIKV [22–24]. Чтобы преодолеть этот врожденный ответ, исследователи использовали мышей с ослабленным иммунитетом, генетически лишенных передачи сигналов IFN типа I, или мышей дикого типа, обработанных антителами для блокирования сигналов IFN типа I [6, 7, 25–27]. Действительно, эти модели воспроизводят несколько болезненных проявлений инфекции ZIKV, наблюдаемых у людей; однако использование мышей с ослабленным иммунитетом препятствует изучению потенциального благоприятного или пагубного воздействия иммунитета хозяина на патогенез заболевания ZIKV.Экспериментальные условия с использованием иммунокомпетентных беременных мышей, которые были исследованы на сегодняшний день, включают прививку мышей чрезвычайно высокими дозами вируса или с помощью специальных методов или операций для прямой доставки вируса к границе раздела матери и плода (например, вагинальное воздействие, внутриутробная инфекция) [7– 10, 18–20]. Эти исследования тоже увенчались успехом. С помощью этих манипуляций вертикальная передача ZIKV от матери к плоду была продемонстрирована на мышах [6, 7, 18, 19], несмотря на фундаментальные различия структур плаценты у людей и мышей.Эти исследования показали, что повреждение плода совпадает с распространением ZIKV на плаценту и эмбрион. Однако эти параметры создавали высокие и устойчивые титры вирусов в кровотоке или в непосредственной близости от плаценты [6, 7, 19], открывая возможность того, что трансплацентарная передача и повреждение плода могли быть вызваны необычно высокими вирусными нагрузками у матери, которые могли не были достигнуты в иммунокомпетентном хозяине.

    Сообщалось о

    CZS у новорожденных людей с бессимптомной материнской ZIKV-инфекцией [4, 28], предполагая, что врожденный иммунный ответ матери может быть достаточным для предотвращения или значительного ослабления болезни, но недостаточен для защиты плода от инфекции или плохого клинического исхода.Мало что известно о последствиях инфекции ZIKV во время беременности, помимо тех, которые возникают непосредственно в результате сильной инфекции ZIKV и вертикальной передачи. Инфекция ZIKV также может повреждать плаценту, приводя к плацентарной недостаточности и патологии [6, 19], что ставит вопрос о том, вызвана ли CZS прямым вирусным воздействием на плод, вторичными эффектами, возникающими в результате первичного повреждения плаценты, или обоими.

    Было показано, что влияние инфекции ZIKV на развивающиеся эмбрионы зависит от стадии гестации [14, 15, 29].Инфекция на ранних сроках беременности, по-видимому, представляет самый высокий риск повреждения плода как у людей, так и у мышей [4–6, 19, 20, 28–30]. Растущие эпидемиологические данные также указывают на риск неблагоприятного исхода для плода, когда инфицирование матери происходит во втором и третьем триместрах [4, 31, 32]. Модели на животных предполагают, что инфекция на ранней стадии до завершения плацентации часто приводит к более высокому уровню передачи вируса и более тяжелым исходам для плода, чем инфекция на более поздней стадии, когда плацента полностью функциональна [6, 19, 20, 29].Вполне возможно, что окно восприимчивости и влияние инфекции ZIKV на исход плода может зависеть от изменений, связанных со стадией беременности, на границе раздела матери и плода.

    В этом исследовании мы использовали иммунологически неманипулятивных мышей C57BL / 6J дикого типа, у которых развивалась ограниченная инфекция ZIKV. Мы обнаружили, что даже у беременных мышей, способных генерировать неповрежденный иммунитет, включая передачу сигналов IFN типа I, тем не менее развивалась плацентарная патология и глубокие аномалии плода, включая IUGR, пороки развития эмбриона и высокую частоту гибели плода.Воздействие на развивающийся эмбрион было вызвано живым инфекционным вирусом и зависело от дозы и времени введения вируса во время беременности. Однако, поскольку репликация вируса была ограничена у иммунокомпетентных мышей, вертикальная передача была редкой, и, следовательно, аномалия плода не была достоверно связана с присутствием ZIKV в материнских тканях, плаценте или эмбрионе. Наши результаты показывают, что неблагоприятный исход для плода в отсутствие вертикальной передачи, вероятно, был связан с патологией плаценты, включая гиперплазию трофобласта в непосредственной близости от эмбриональных кровеносных сосудов в лабиринте и некроз гигантских клеток трофобласта в зоне соединения.Наши результаты показывают, что в этой модели патология плаценты, ведущая к плацентарной недостаточности, а не передача вируса, может привести к серьезным неблагоприятным последствиям для плода. В целом, наши результаты свидетельствуют о важности модели беременности ZIKV, которая позволяет обнаруживать патологию плаценты и аномалии плода даже при очень низких уровнях общей вирусной инфекции, чтобы проверить вмешательства, которые могут обеспечить защитные преимущества от всего спектра вредных плацентарных и патологических состояний. последствия для плода, выходящие за рамки простого предотвращения вертикальной передачи.

    Результаты

    Внутривенное инфицирование ZIKV беременных иммунокомпетентных мышей C57BL / 6J дикого типа приводит к гибели плода

    Мы заразили беременных мышей C57BL / 6J дикого типа внутривенно 3,4 × 10 5 БОЕ ZIKV Puerto Rico штамма PRVABC59 в эмбриональный день 9,5 (E9.5) беременности, то есть непосредственно перед полной плацентацией (E10 -E10.5). Мышей умерщвляли через 8 дней после инфицирования (dpi) на ст. E17.5, и матки и отдельные эмбрионы оценивали по морфологическому виду и массе (схема, представленная на фиг. 1A).Мок-инфицированные мыши или мыши, которым вводили инактивированный нагреванием ZIKV, не показали явных различий по сравнению с необработанными мышами (фиг. 1B, 3 панели слева). Напротив, матки живых мышей, инфицированных ZIKV, содержали эмбрионы, подвергшиеся гибели плода (рис. 1B, правые 3 панели). В некоторых случаях все эмбрионы подверглись полной резорбции, оставив только плацентарные остатки и эмбриональные остатки внутри суженного амниотического мешка. В других случаях самки несли смесь остатков плаценты и / или морфологически аномальных эмбрионов.Несколько оставшихся эмбрионов продемонстрировали ряд значительных ограничений роста и пороков развития, а также значительно снизился вес (S1, рис.). Все 16 инфицированных ZIKV самок показали аномальную беременность в том смысле, что все они несли по крайней мере один или несколько мертвых эмбрионов или плацентарных остатков, или морфологически аномальных, но живых эмбрионов (рис. 1C, левая панель). Из 120 мест имплантации в инфицированных ZIKV самках 85% были затронуты, демонстрируя полную резорбцию эмбриона (то есть гибель) или признаки ограничения роста, уродства или анатомического дефекта развития при общем морфологическом исследовании (рис. 1C, правая панель).Эти данные демонстрируют, что этот экспериментальный протокол приводит к хорошо воспроизводимой модели крайне неблагоприятных исходов для плода, связанных с ZIKV.

    Рис. 1. Инфекция ZIKV беременных мышей C57BL / 6J приводит к гибели плода, вызванной живым инфекционным вирусом.

    ( A ) Схема заражения и последующие анализы. Для B и C беременные самки в эмбриональный день 9,5 (E9.5) были инфицированы 3,4 × 10 5 БОЕ ZIKV внутривенным путем.Контрольных мышей оставляли необработанными (неинфицированными) или инокулировали супернатантом клеточной культуры Vero (Mock) или 3,4 × 10 5 БОЕ-эквивалента инактивированного нагреванием ZIKV (Inact. ZIKV). Для D и E ZIKV не лечили (ZIKV) или предварительно обрабатывали изотипом мышиного IgG2a (Isotype), нейтрализующими mAb против ZIKV (mAb ZK-67) или иммунной сывороткой, полученной от взрослых мышей, инфицированных ZIKV. (Иммунная сыворотка ЗИКВ). Беременных самок на ст. E9.5 затем инфицировали 3,4 × 10 5 БОЕ-эквивалента обработанного ZIKV внутривенным путем.Контрольным мышам инокулировали супернатант клеточной культуры Vero (Mock). Мышей умерщвляли через 8 дней после инфицирования (dpi) на E17.5, и материнские ткани, плаценты и эмбрионы собирали и исследовали. ( B ) Типичные изображения матки E17.5. В матке мышей, инфицированных ZIKV, наблюдалась полная или частичная гибель плода. Стрелки указывают на плацентарные остатки резорбированных эмбрионов. Стрелками указаны оставшиеся неповрежденные эмбрионы. ( C ) Воздействие инфекции ZIKV на самок и эмбрионы на E17.5. Процент маток, показывающих аномальную беременность (т.е. хотя бы один эмбрион в помете показал морфологические отклонения или претерпел гибель / резорбцию), показан на левой панели. Процент затронутых эмбрионов (то есть подвергшихся гибели / резорбции или проявивших какие-либо признаки ограничения роста, уродства или анатомического дефекта развития при общем морфологическом исследовании) показан на правой панели. Цифры на столбцах указывают на нормальную беременность / эмбрион (вверху) или ненормальную беременность / пораженный эмбрион (внизу).(нс, не значимо; **** p <0,0001 по сравнению с числами в незараженной группе по точному критерию Фишера). ( D ) Типичные изображения матки и эмбрионов или остатков плаценты, переносимых самками, инфицированными предварительно обработанным ZIKV. У маток и эмбрионов самок, инфицированных ZIKV, обработанным mAb или иммунной сывороткой, не обнаружено никаких отклонений от нормы по сравнению с таковыми при фиктивной инфекции. ( E ) Воздействие инфекции предварительно обработанным ZIKV на самок и эмбрионы на E17.5, как описано в (C). (нс, не значимо; ** p <0.01; **** p <0,0001 по сравнению с числами в группе имитации по точному критерию Фишера). Данные для всех панелей объединены из 5 (B и C) или 2 (D и E) независимых экспериментов.

    https://doi.org/10.1371/journal.ppat.1006994.g001

    Чтобы подтвердить, что живой инфекционный ZIKV является возбудителем этих неблагоприятных исходов для плода, мы предварительно обработали инокулят перед инфицированием нейтрализующим ZIKV-специфическим mAb, ZK-67 [33], или иммунная сыворотка, полученная от взрослых мышей, инфицированных ZIKV (схема, представленная на рис. 1A).Результаты, показанные на фиг. 1D и количественно выраженные на фиг. 1E, показывают, что все самки, инфицированные необработанным ZIKV или ZIKV, обработанным нерелевантным изотипом, показали аномальную беременность, и более 90% их эмбрионов были затронуты (т.е. умерли или были аномальными). Напротив, самки, инфицированные ZIKV, предварительно обработанные либо mAb ZK-67, либо иммунной сывороткой, и их эмбрионы не показали явных морфологических различий или статистической значимости по сравнению с теми, которые были инокулированы супернатантом культуры клеток Vero (то есть имитацией инфекции).Вместе эти данные демонстрируют, что серьезные неблагоприятные исходы для плода являются результатом живого инфекционного ZIKV, а не других иммуностимулирующих молекул, которые потенциально могут присутствовать в инокуляте.

    Воздействие инфекции ZIKV на гибель плода зависит от начальной дозы инфицирования и гестационного возраста

    Чтобы определить, является ли гибель плода, вызванная ZIKV-инфекцией, дозозависимой, и оценить, может ли тяжесть заболевания модулироваться более низким инокулятом вируса, мы инфицировали беременных самок на E9.5 с 3,4, 1 или 0,34 × 10 5 БОЕ и умерщвляли мышей через 8 дней (схема, представленная на фиг. 2А). Как показано на рис. 2В и 2С, мы наблюдали дозозависимый эффект вирусного инокулята как на количество / процент пораженных эмбрионов (рис. 2В), так и на степень поражения эмбрионов, переносимых отдельными самками (рис. 2С). В то время как 85% от общего числа эмбрионов, переносимых самками, инфицированными 3,4 × 10 5 БОЕ, были поражены, было поражено только 36% от общего числа эмбрионов, переносимых самками, инфицированными 1 × 10 5 БОЕ, что все еще было значительно выше, чем неинфицированных плотин (рис. 2B).Напротив, было затронуто менее 3% от общего числа эмбрионов, переносимых самками, инфицированными 3,4 × 10 4 БОЕ (рис. 2В). По мере того, как доза исходной вирусной инокуляции постепенно уменьшалась, также уменьшалось соотношение морфологически пораженных эмбрионов к нормальным эмбрионам, переносимым каждой отдельной маткой (рис. 2С). Эти данные указывают на дозозависимый эффект введенного вирусного инокулята на исход для плода.

    Рис. 2. Неблагоприятные исходы для плода, связанные с ZIKV, зависят от начальной дозы и гестационного возраста материнской инфекции.

    ( A-C ) Беременных самок на ст. E9.5 инфицировали 3,4, 1 или 0,34 × 10 5 БОЕ ZIKV внутривенно и умерщвляли с 8 dpi на ст. E17,5. Контрольные мыши остались незараженными. Неинфицированные группы и 3,4 × 10 5 группы были такими же, как показано на фиг. 1C. ( A ) Схема заражения. ( B ) Влияние дозы инокулята ZIKV на эмбрионы, как показано на рис. 1C. Цифры на столбцах указывают нормальный эмбрион (вверху) или пораженный эмбрион (внизу). (нс, не значимо; *** p <0.001; **** p <0,0001 по сравнению с числами между указанными группами по точному критерию Фишера). ( C ) Влияние инфекции ZIKV на количество пораженных эмбрионов, переносимых каждой отдельной маткой. Количество плотин в каждой группе указано ниже в скобках. Символы показывают количество эмбрионов от каждой матери с указанными эмбриональными исходами. Показанные данные являются медианными с межквартильным размахом. (нс, недостоверно; ** p <0,01; *** p <0,0001 по критерию Манна-Уитни). ( D-E ) Беременные самки были инфицированы 3.4 × 10 5 PFU ZIKV на E9.5 или E12.5 и 5 точек на дюйм на E14.5 или E17.5 соответственно. ( D ) Схема заражения. ( E ) Влияние времени инфицирования ZIKV на эмбрионы, как показано на рис. 1C. (нс, не значимо; **** p <0,0001 по точному критерию Фишера). N / A, не применимо.

    https://doi.org/10.1371/journal.ppat.1006994.g002

    Чтобы исследовать влияние стадии гестации и зрелости плаценты на побочные эффекты, связанные с ZIKV, мы инфицировали самок 3.4 × 10 5 PFU ZIKV на E9.5 или E12.5 и сравнили материнские и эмбриональные исходы при 5 dpi (схема, представленная на рис. 2D). В соответствии с нашим предыдущим наблюдением (рис. 1), мы наблюдали неблагоприятные исходы для плода у маток, инфицированных на ст. E9.5: были затронуты 90% эмбрионов (рис. 2E). Напротив, когда матери были инфицированы на E12.5, только 13% их эмбрионов были поражены (рис. 2E). Таким образом, срок беременности, в котором мыши столкнулись с ZIKV, резко повлиял на тяжесть исхода для плода.

    РНК вируса ZIKV обнаруживается в некоторых тканях матери, плаценте и эмбрионах, но ее присутствие не является надежным индикатором неблагоприятных исходов для плода

    Чтобы исследовать инфекционный статус самок после воздействия ZIKV, мы измерили уровни РНК ZIKV в нескольких тканях матери (селезенка, печень, почки, мозг и сыворотка) с помощью количественной полимеразной цепной реакции с обратной транскрипцией в реальном времени (RT-PCR).Все инфицированные ZIKV самки демонстрировали определяемые и сопоставимые уровни РНК ZIKV в селезенках, независимо от начальной дозы инокулята (рис. 3A). Однако РНК ZIKV редко обнаруживалась в печени, почках и головном мозге, а в сыворотке одной самки на очень низком уровне, когда самки были инфицированы самой высокой дозой (т.е. 3,4 × 10 5 БОЕ) (Рис. 3B ). Ни у одной из самок, инфицированных двумя более низкими дозами, не было обнаруживаемых уровней РНК ZIKV в печени, почках или сыворотке.

    Рис 3.РНК ZIKV обнаруживается, но ее присутствие не коррелирует с исходами для плода.

    ( A-D ) Беременных самок на ст. E9.5 инфицировали 3,4, 1 или 0,34 × 10 5 БОЕ ZIKV внутривенным путем и умерщвляли с 8 dpi на ст. E17,5. Уровни РНК ZIKV измеряли с помощью количественной ПЦР в реальном времени. ( A ) Уровни РНК ZIKV в селезенке самок, инфицированных 3 дозами ZIKV. ( B ) Уровни РНК ZIKV в печени, почках, головном мозге или сыворотке у самок, инфицированных 3.4 × 10 5 БОЕ. ( C ) Уровни РНК ZIKV во всех образцах плаценты, переносимых самками, инфицированными 3 дозами (левая панель), или остатками плаценты, или оставшимися интактными эмбрионами и их соответствующими плацентами, переносимыми самками, инфицированными 3,4 × 10 5 БОЕ (правая панель) ). ( D ) Резюме эмбрионального исхода в отношении присутствия вирусной РНК. В таблице показано количество и процент эмбрионов, которые были затронуты (Aff) или нормальные (N) при отсутствии (-) или наличии (+) обнаруживаемой РНК ZIKV с помощью ПЦР в реальном времени в плаценте, соответствующих эмбрионах или обоих.Пораженные эмбрионы включают эмбрионы, которые подверглись гибели / резорбции или показали какие-либо признаки ограничения роста, уродства или анатомического дефекта развития при общем морфологическом исследовании. Тест хи-квадрат не выявил статистически значимой связи между присутствием вирусной РНК и эмбриональным исходом (p = 0,97). ( E ) Беременных самок инфицировали 3,4 × 10 5 БОЕ ZIKV на E9,5 или E12,5 и умерщвляли 5 dpi на E14,5 или E17,5, соответственно. Уровни РНК ZIKV в материнской селезенке, плаценте или головке эмбриона измеряли с помощью количественной ПЦР в реальном времени.( A-C и E ) Показанные данные являются медианными с межквартильным размахом. Пунктирная линия обозначает предел обнаружения. (нс, не значимо по критерию Манна-Уитни). Количество образцов в каждой группе указано в скобках. Данные для всех панелей объединены из 2–5 независимых экспериментов.

    https://doi.org/10.1371/journal.ppat.1006994.g003

    Чтобы определить способность ZIKV достигать плаценты и инфицировать эмбрион, мы измерили уровни РНК ZIKV в плацентарных остатках резорбированных эмбрионов и в оставшиеся неповрежденные эмбрионы и соответствующие им плаценты.Мы обнаружили РНК ZIKV в некоторых, но не во всех плацентах плотин, инфицированных всеми тремя дозами (рис. 3C, левая панель), что указывает на способность ZIKV инфицировать плаценту, несмотря на неповрежденный иммунитет самок и независимо от дозы инокулята ZIKV. В случаях гибели плода у самок, инфицированных самой высокой дозой, мы обнаружили РНК ZIKV в 15 из 45 плацентарных остатков, некоторые из которых демонстрировали высокие уровни РНК (рис. 3C, правая панель). Однако оставшиеся 30 из 45 плацентарных остатков не содержали детектируемой РНК ZIKV, даже несмотря на то, что все соответствующие им эмбрионы подверглись полной резорбции (рис. 3C, правая панель).Из 8 оставшихся эмбрионов, которые не были реабсорбированы, РНК ZIKV обнаруживалась только в одном эмбрионе (голове) на очень низком уровне, но не в соответствующей ему плаценте (рис. 3C, правая панель). В целом, не было статистически значимой связи между присутствием выявляемой РНК ZIKV в плаценте и / или эмбрионе и морфологическим исходом эмбриона (p = 0,97, критерий хи-квадрат; рис. 3D).

    Когда матери были инфицированы в разном гестационном возрасте (например, E9.5 или E12.5), РНК ZIKV обнаруживалась во всех селезенках матери после 5 дней заражения (рис. 3E).Примечательно, что уровни РНК ZIKV были сопоставимы независимо от того, когда матери были инфицированы, что означает, что беременные взрослые мыши одинаково восприимчивы к инфекции ZIKV на E9.5 и E12.5, даже если их эмбрионы показывают разные результаты (рис. 2E). Интересно, что в то время как 32% плаценты, переносимой самками, инфицированными на E9.5, имели детектируемую РНК ZIKV, 68% плаценты, переносимой самками, инфицированными на E12.5, имели детектируемую РНК ZIKV (рис. 3E), демонстрируя большее проникновение через плаценту на E12. 5 по сравнению с E9.5. Несмотря на это, ни один эмбрион, переносимый самками, инфицированными на ст. E12.5, не имел детектируемой РНК ZIKV (рис. 3E). Это согласуется с нашим предыдущим наблюдением (рис. 3D), что РНК ZIKV, обнаруженная в плотинах, плаценте или эмбрионах после инфицирования, не связана с неблагоприятным исходом для плода; таким образом, остаточный уровень РНК ZIKV является ненадежным индикатором в этой модели.

    Ряд неблагоприятных исходов для плода проявляется рано и соответствует дозировке

    Полная гибель и рассасывание плода наблюдается через 5 или 8 точек на дюйм после инфицирования матери на E9.5 подчеркивает разрушительные последствия материнской инфекции ZIKV, но не проливает свет на патофизиологические события, которые приводят к крайнему исходу. Тот факт, что мы не обнаружили РНК ZIKV во всех пораженных плаценте и эмбрионах в эти моменты времени, не может исключить возможность того, что заболеваемость плода была связана с инфекцией ZIKV плаценты и эмбриона, которая произошла раньше, но больше не определялась во время урожай. Чтобы выяснить, происходит ли ранняя вертикальная передача, и действительно ли вертикальная передача вируса или другие ранние события, связанные с ZIKV, такие как патология плаценты, способствуют возможной гибели плода, мы заразили самок на E9.5 с 3,4 или 1 × 10 5 БОЕ ZIKV и умерщвляли мышей через 1–4 дня после заражения (схема, представленная на фиг. 4A). В соответствии с нашим предыдущим наблюдением при 5 и 8 dpi (рис. 3E и 3A, соответственно), все плотины содержали РНК ZIKV в селезенках во все более ранние моменты времени (рис. 4B). Уровни РНК ZIKV были самыми высокими в селезенке при 1 dpi, затем постепенно снижались. Примечательно, что уровни РНК ZIKV в селезенке существенно не различались между самками, инфицированными 3,4 или 1 × 10 5 PFU ZIKV в различные моменты времени.Кроме того, РНК ZIKV была обнаружена только в материнской сыворотке при 1 dpi (фиг. 4C), что свидетельствует о быстром выведении ZIKV из материнской циркуляции у иммунокомпетентных мышей без установления длительной виремии. Уровни вируса в сыворотке в двух инфицированных группах существенно не различались. Хотя РНК ZIKV была обнаружена, инфекционный вирус, если он присутствует в материнской селезенке или сыворотке, был ниже предела обнаружения стандартного анализа бляшек во все моменты времени, что еще раз подтверждает, что инфекция ZIKV была ограничена, но приводила к неблагоприятному исходу для плода.

    Рис. 4. Ряд патологий плода проявляется рано и соответствует дозировке, но не уровню вирусной РНК.

    Беременных самок на ст. E9.5 инфицировали 3,4 или 1 × 10 5 БОЕ ZIKV внутривенно и умерщвляли через 1–4 точки на дюйм. Контрольные мыши остались незараженными. ( A ) Схема заражения. ( B и C ) Уровни РНК ZIKV в селезенке ( B ) или сыворотке ( C ) инфицированных ZIKV самок. ( D ) Репрезентативные изображения матки и эмбрионов с разрешением 2–4 dpi.Звездочкой отмечены плацентарные остатки умерших / резорбированных эмбрионов. Аномалии плода наблюдались уже на 2 dpi, с дальнейшим ухудшением в течение следующих 24–48 часов до тяжелой гибели плода. ( E и F ) Уровни РНК ZIKV в плаценте ( E ) или целом эмбрионе ( F ). ( B , C , E и F ) Уровни РНК ZIKV измеряли с помощью количественной ПЦР в реальном времени. Пунктирная линия обозначает предел обнаружения. Показанные данные являются медианными с межквартильным размахом.Данные для всех панелей объединены из 2 независимых экспериментов.

    https://doi.org/10.1371/journal.ppat.1006994.g004

    Грубое морфологическое исследование матки и эмбрионов у инфицированных ZIKV самок выявило визуально очевидные аномалии плода (например, ограничение роста, остановка роста и задержка развития) уже на 2 dpi, с дальнейшим ухудшением в течение следующих 24–48 часов, включая тяжелую гибель плода (рис. 4D). При 4 dpi эмбрионы переносятся самками, инфицированными 3.4 × 10 5 PFU ZIKV уже часто были обесцвеченными, очевидно бескровными и, вероятно, нежизнеспособными (рис. 4D). В соответствии с нашим предыдущим наблюдением (рис. 2), исход плода у маток, инфицированных 1 × 10 5 PFU ZIKV, был менее тяжелым, чем у маток, инфицированных 3,4 × 10 5 PFU ZIKV (рис. 4D). Примечательно, что разрушение эмбрионов не происходило синхронно для всего помета, что позволяет нам наблюдать разную степень ранних аномалий плода и общую задержку развития.Кроме того, в соответствии с нашим предыдущим наблюдением (рис. 3), РНК ZIKV обнаруживалась только спорадически в плаценте (рис. 4E) и эмбрионах (рис. 4F) в эти более ранние моменты времени. В то время как все эмбрионы были затронуты при 3 dpi, 70% не содержали обнаруживаемой РНК ZIKV в плаценте или эмбрионах, что указывает на то, что значительная вертикальная передача не происходила у большинства пораженных эмбрионов даже в более ранние временные точки.

    Инфекция ZIKV приводит к патологии плаценты, что соответствует неблагоприятному исходу для плода

    Наш анализ показал, что уровень РНК ZIKV в плаценте или эмбрионе не предсказывал неблагоприятный исход для плода даже в более ранние моменты времени.Впоследствии мы искали гистопатологические поражения плаценты, которые могут объяснить гибель плода при 3 и 4 точках на дюйм. Мы обнаружили некроз эмбрионального эндотелия внутри эмбриональных кровеносных сосудов в плацентарном лабиринте (рис. 5А). Белковый антиген оболочки ZIKV (E) был обнаружен в эндотелии эмбриональных кровеносных сосудов в плацентарном лабиринте, но не в эмбриональных клетках или тканях в любое изученное время (рис. 5B). Линейная «плоская» картина окрашивания антигеном убедительно свидетельствует о том, что антиген ZIKV локализован преимущественно в длинных и тонких эмбриональных эндотелиальных клетках, которые выстилают эмбриональные кровеносные сосуды и имеют плоские ядра овальной формы.Кроме того, остатки некротических клеток внутри сосудистой сети эмбриона часто сопровождали окрашивание вируса (рис. 5B), что позволяет предположить, что кровообращение в плаценте и эмбрионе могло быть нарушено, скорее всего, из-за воздействия ZIKV и последующего разрушения эмбриональных эндотелиальных клеток. Этот клеточный дебрис мог происходить из некротического эндотелия и других клеток.

    Рис. 5. Антиген ZIKV совместно локализуется с эмбриональными эндотелиальными клетками в плацентарном лабиринте и ассоциируется с повреждением.

    Беременных самок на ст. E9.5 инфицировали 3,4 × 10 5 БОЕ ZIKV и умерщвляли при 3 и 4 dpi. Залитые в парафин ткани плаценты окрашивали H&E ( A и C ) или белком ZIKV E (красный) с контрастным красителем гематоксилин (синий) ( B и C ). Показаны репрезентативные изображения эмбриональных кровеносных сосудов в плацентарном лабиринте. ( A ) Некроз внутри эмбриональных кровеносных сосудов. ( B ) Антиген ZIKV был обнаружен в эмбриональных эндотелиальных клетках эмбриональных кровеносных сосудов плацентарного лабиринта.Стрелки указывают на ядросодержащие эритроциты эмбриона. Стрелки указывают на окрашивание антигена ZIKV и выделяют морфологию инфицированных клеток и образец окрашивания антигена. Звездочками обозначены участки остатков некротических клеток. ( C ) Ткани от неинфицированных самок того же гестационного возраста использовали в качестве отрицательного контроля. МС — материнский синус; EV, эмбриональный кровеносный сосуд. Шкала 50 мкм или 25 мкм.

    https://doi.org/10.1371/journal.ppat.1006994.g005

    Общее гистологическое исследование плаценты, ассоциированной с морфологически аномальными эмбрионами, независимо от того, был обнаружен вирусный антиген или нет, показало, что наиболее заметные патологические изменения плаценты были очаговая или диффузная гиперплазия лабиринта трофобласта (рис. 6А), дегенерация и некроз гигантских клеток трофобласта в зоне соединения (рис. 6В).Мы также наблюдали локализованные участки некротических клеток и тромбов в пространствах материнской крови в лабиринте по крайней мере одной плаценты (рис. 6С). Гиперплазия трофобласта в лабиринте была очевидна с очаговой или диффузной базофилией трофобластов лабиринта и митотическими трофобластами (рис. 6А) в непосредственной близости от кровеносных сосудов эмбриона и кровеносных пространств матери (синусоиды, выстланные трофобластом). Обломки некротических клеток указывали на очаговый некроз в зоне соединения (рис. 6В). Мы постоянно наблюдали эти особенности уже на 1 dpi, подразумевая, что они не могли быть вызваны прямой вирусной инфекцией плацентарных клеток.Более того, в то время как очаговый некроз в лабиринте наблюдался при 2 dpi, эмбрионы начали показывать некоторый очаговый некроз только при 3 и 4 dpi, указывая на то, что поражения плаценты развились раньше, чем у эмбрионов. Хотя некроз плаценты мог быть недостаточно серьезным, чтобы сам по себе вызвать плацентарную недостаточность, основные анатомические поражения, гиперплазия лабиринтного трофобласта и потеря эмбриональных кровеносных сосудов (рис. 6D) после эндотелиального некроза, вероятно, мешали обмену питательными веществами эмбриона в достаточной степени, чтобы вызвать гипоксию эмбриона. .Взятые вместе, эти данные предполагают, что после воздействия ZIKV у матери нормальная архитектура и функция плаценты были существенно нарушены, что привело к плацентарной недостаточности, ведущей к гибели плода, даже без широко распространенной прямой вирусной инфекции эмбрионов.

    Рис. 6. Инфекция ZIKV у матери вызывает повреждение плаценты.

    Беременных самок на ст. E9.5 инфицировали 3,4 × 10 5 БОЕ ZIKV и умерщвляли при 3 dpi. Залитые парафином ткани плаценты окрашивали H&E.Показаны репрезентативные изображения. ( A ) Гиперплазия лабиринтного трофобласта в плаценте инфицированных маток. Стрелки указывают трофобласты митотического лабиринта. Шкала 50 мкм или 10 мкм. ( B ) Некроз гигантских клеток трофобласта в зоне соединения. Стрелки указывают нормальную ткань (слева) или остатки некротических клеток (справа). D, децидуальная оболочка; JZ, стыковая зона. Масштабная линейка 25 мкм. ( C ) Тромбы в материнских или эмбриональных кровеносных сосудах в лабиринте. Стрелки указывают на тромбы. Масштабная линейка 50 мкм.( D ) Потеря эмбриональных кровеносных сосудов, характеризующаяся отсутствием ядерных эмбриональных эритроцитов, в лабиринте инфицированных маток. Стрелки указывают на ядросодержащие эритроциты эмбриона. Масштабная линейка 50 мкм.

    https://doi.org/10.1371/journal.ppat.1006994.g006

    В качестве дополнительной поддержки этой точки зрения гистологическая оценка неизменно указывала на отсутствие значительных различий в плаценте между неинфицированными и инфицированными на E12 плотинами.5 (рис 7). Это согласуется с их нормальной эмбриональной морфологией, которую мы наблюдали при 5 dpi у этих маток (рис. 2E). Признаков гиперплазии трофобластов или некротических / апоптотических клеток в лабиринте плаценты от маток, инфицированных на E12.5, не было (рис. 7A и 7B, правые панели), по сравнению с таковыми от маток, инфицированных на E9.5. которые показали значительные поражения (рис. 7A и 7B, левые панели). Эти данные показывают, что плаценты и эмбрионы на ст. E9.5 могут быть более уязвимыми и, следовательно, проявлять большую патологию, чем на ст. E12.5, которые кажутся относительно незатронутыми. Хотя ПЦР в реальном времени выявила РНК ZIKV в ткани плаценты, инфицированной на ст. E12.5 (рис. 3E), мы не смогли обнаружить антиген ZIKV с помощью иммуногистохимии (рис. 7B).

    Рис. 7. Патология плаценты ZIKV-инфицированных самок зависит от времени воздействия во время беременности.

    Беременных самок инфицировали 3,4 × 10 5 БОЕ ZIKV на E9.5 или E12.5 и умерщвляли 5 dpi на E14.5 (левые панели) или E17.5 (правые панели), соответственно, как показано на рис. 2D.Показаны репрезентативные изображения плацентарного лабиринта, окрашенного H&E ( A ) или белком ZIKV E (красный) с контрастным красителем гематоксилином (синий) ( B и C ). Некроз и вирусный антиген наблюдались в лабиринте маток, инфицированных на E9.5, но не у маток, инфицированных на E12.5. Стрелки указывают на ядросодержащие эритроциты эмбриона. Стрелки указывают на окрашивание антигена ZIKV и выделяют морфологию инфицированных клеток и характер окрашивания антигеном. Звездочками обозначены участки остатков некротических клеток.( C ) Ткани неинфицированных самок того же гестационного возраста использовали в качестве отрицательного контроля для окрашивания на вирусы. МС — материнский синус; EV, эмбриональный кровеносный сосуд. Шкала 50 мкм или 25 мкм.

    https://doi.org/10.1371/journal.ppat.1006994.g007

    Плаценты у самок, инфицированных на ст. E12.5, выглядели относительно здоровыми (рис. 7), несмотря на более высокие уровни РНК ZIKV (рис. 3E). Это, в сочетании с наблюдением, что ни плацентарный, ни эмбриональный уровни РНК ZIKV не были надежными предикторами исхода для плода (рис. 3 и 4), позволяет предположить, что здоровье плаценты является более значимым прогностическим фактором неблагоприятного исхода для плода, чем уровень плацентарной или эмбриональной РНК ZIKV.Однако следует подчеркнуть, что патология плаценты, наблюдаемая в нашей модели, еще не была напрямую связана с плацентарной недостаточностью как причиной высокой частоты гибели плода.

    Перенос иммунной сыворотки выздоравливающего показывает, что морфологический результат плода является полезным показателем для оценки эффективности потенциальных защитных мер

    Чтобы продемонстрировать полезность нашей модели и проверить, может ли морфологический результат плода служить быстрым считыванием для первоначального скрининга кандидатных вакцин и терапевтических средств против инфекции ZIKV, мы провели доказательные исследования с использованием потенциальной защитной терапии — иммунной сыворотку, взятую у выздоравливающих взрослых мышей, инфицированных ZIKV.Когда беременные самки получали иммунную сыворотку до инфицирования (схема, показанная на фиг. 8A), их матки и эмбрионы не демонстрировали явных морфологических различий по сравнению с ложно инфицированными самками, в то время как самки, получавшие физиологический раствор или наивную сыворотку, демонстрировали полную гибель плода (фиг. 8B). Иммунная сыворотка значительно снизила количество и процент пораженных самок (рис. 8C) и эмбрионов (рис. 8D) до уровня, который был сопоставим с имитацией инфекции. Он также значительно снизил РНК ZIKV в материнской селезенке при 8 dpi (рис. 8E).Более того, вес эмбрионов, переносимых самками, получившими иммунную сыворотку, существенно не отличался от веса эмбрионов, переносимых самками, получившими фиктивную инфекцию (рис. 8F). Вместе с результатами, показанными ранее на рис. 1D и 1E, эти результаты показывают, что иммунная сыворотка может предотвратить неблагоприятный исход для плода в условиях беременности, и демонстрируют, что в этой модели жизнеспособность эмбриона и крупная морфология матки и эмбриона могут быть быстрыми и легкими. in vivo фенотипические считывания для раннего скрининга эффективности вакцин-кандидатов и терапевтических средств против инфекции ZIKV.

    Рис. 8. Перенос иммунной сыворотки выздоравливающих пациентов демонстрирует полезность морфологического исхода плода при оценке защитной эффективности.

    Беременных самок на ст. E8.5 обрабатывали внутрибрюшинно PBS, 50 мкл сыворотки от инфицированных ZIKV мышей (иммунная сыворотка ZIKV) или 250 мкл сыворотки от наивных мышей (наивная сыворотка). Самок инфицировали на E9.5 с помощью 3,4 × 10 5 БОЕ ZIKV внутривенным путем и умерщвляли 8 dpi на E17.5. Контрольным мышам вводили супернатант клеточной культуры Vero (Mock).( A ) Схема заражения. ( B ) Типичные изображения матки и эмбрионов или остатков плаценты. ( C и D ) Влияние обработки сывороткой на самок ( C ) или эмбрионов ( D ), как показано на рис. 1C. Цифры на столбцах указывают на нормальную беременность / эмбрион (вверху) или ненормальную беременность / пораженный эмбрион (внизу). (нс, не значимо; * p <0,05; ** p <0,01; **** p <0,0001 по сравнению с числами в группе имитации по точному критерию Фишера). ( E ) Уровни РНК ZIKV в селезенке инфицированных ZIKV самок, измеренные с помощью количественной ПЦР в реальном времени.Показанные данные являются медианными с межквартильным размахом. Пунктирная линия обозначает предел обнаружения. (нс, недостоверно; * p <0,05; ** p <0,01 по критерию Манна-Уитни). ( F ) Вес эмбриона. Процент указывает на эмбрионы, подвергшиеся полной резорбции. Показанные данные являются медианными с межквартильным размахом. (нс, не значимо; **** p <0,0001 по сравнению с группой Mock по критерию Манна-Уитни). Данные для всех панелей представляют собой один представитель 2 независимых экспериментов с 4-6 беременными самками в каждой группе в каждом эксперименте.

    https://doi.org/10.1371/journal.ppat.1006994.g008

    Ранняя послеродовая смерть новорожденных, рожденных от маток, инфицированных ZIKV на E12.5

    Важно отметить, что, несмотря на отсутствие явных эмбриональных аномалий через 5 дней после материнской инфекции E12.5 (рис. 2E), мы не можем сделать вывод, что эти эмбрионы будут избавлены от будущих патологических последствий. Действительно, когда параллельной когорте самок было разрешено вынашивать беременность до срока (схема, показанная на рис. 9A), мы наблюдали значительное снижение веса новорожденных, рожденных от инфицированных ZIKV самок (рис. 9B), а также заметное увеличение неонатальной заболеваемости. в течение 24 часов после рождения (рис. 9C).Мы пока не знаем, было ли это послеродовым эффектом для новорожденных от воздействия ZIKV в утробе матери или просто материнской халатностью и / или гибелью новорожденных, которые были низкорослыми, возможно, в результате заражения материнским вирусом. Тем не менее, наши результаты показывают, что в этой иммунокомпетентной модели мышей воздействие ZIKV на мать на более поздних стадиях беременности может по-прежнему представлять риск неблагоприятных послеродовых последствий, даже при отсутствии острой патологии плода внутриутробно, или при рождении.

    Рис. 9. Новорожденные от маток, инфицированных на ст. E12.5, демонстрируют значительный уровень ранней постнатальной смерти.

    Беременных самок инфицировали 3,4 × 10 5 БОЕ на ст. E12.5 и умерщвляли 5 dpi на ст. Ст. 17,5 или оставляли до срока. Матери и новорожденные были обследованы в течение 24 ч после родов. ( A ) Схема заражения. ( B ) E17.5 Вес эмбриона и новорожденного. Показанные данные являются средними с SD. (нс, не значимо; **** p <0,0001 по сравнению с неинфицированной группой по тесту Student t ) ( C ) Жизнеспособность новорожденного.Цифры на столбцах указывают на новорожденных, которые были живы (вверху) или родились живыми, но умерли в течение 24 часов после рождения (внизу). (нс, недостоверно; ** p <0,01 по сравнению с числами в незараженной группе по точному критерию Фишера). Данные для всех панелей объединены из 2–3 независимых экспериментов. N / A, не применимо.

    https://doi.org/10.1371/journal.ppat.1006994.g009

    Обсуждение

    Мы сообщаем о высоко воспроизводимой модели беременности у ZIKV-инфицированных иммунокомпетентных мышей C57BL / 6J, демонстрирующей высокую частоту неблагоприятных исходов беременности, включая глубокие морфологические аномалии плода и гибель плода, при отсутствии вертикальной передачи вируса.Эта модель выявила патологию плода, патологию плаценты и потенциальное послеродовое влияние. Из этого исследования можно сделать несколько ключевых наблюдений. Во-первых, инфекция ZIKV беременных иммунологически интактных мышей на ст. E9.5 вызвала драматические пагубные последствия для плода. Это было вызвано инфекционным вирусом и зависело от введенной начальной дозы вируса. Во-вторых, патология плаценты постоянно наблюдалась в пораженных концептах, независимо от обнаруживаемой РНК ZIKV или белка в плаценте и / или эмбрионах. В-третьих, в то время как сами беременные иммунокомпетентные самки сопротивлялись воздействию инфекции ZIKV, их эмбрионы казались чрезвычайно чувствительными к инфекции, и этот эффект зависел от времени инфицирования во время беременности.В-четвертых, даже при отсутствии острой патологии плода в утробе или при рождении, детеныши, рожденные от инфицированных ZIKV самок, тем не менее, могут пострадать.

    Наши результаты опровергают концепцию, согласно которой неблагоприятный исход для плода, связанный с ZIKV, является просто результатом проникновения вируса через плаценту и прямого воздействия на плод. Скорее, мы показываем, что неблагоприятный исход для плода может произойти при очевидном отсутствии значительной прямой инфекции плода. Наши данные подтверждают модель плацентарной недостаточности как одной из причин гибели плода в иммунокомпетентных условиях.Более того, Yockey et al. показали, что повреждение плаценты, потенциально способное нанести вред эмбриону, может быть результатом иммунопатологии типа I, запускаемой IFN [34]. Взятые вместе, эти результаты согласуются с исследованиями на беременных макаках-резус и людях, в которых сообщалось, что тяжесть исхода для плода, как правило, не коррелировала с клинической тяжестью материнского заболевания, уровнем РНК ZIKV в сыворотке или моче или продолжительностью материнского виремия [28, 35], и повышают вероятность того, что исход материнского заболевания не может строго прогнозировать исход для плода.

    Люди обычно заражаются ZIKV во время кормления комаров, который, по оценкам, доставляет от 10 4 до 10 6 БОЕ в родственных флавивирусах WNV и DENV [36, 37]. Хотя введенные нами дозы находились в этом диапазоне, существует вероятность того, что реакции, вызванные экспериментальной внутривенной инфекцией, могут отличаться от ответов, вызванных укусами комаров у людей. Действительно, недавняя публикация обнаружила, что инфицирование через укусы комара задерживает репликацию ZIKV по сравнению с инокулятом иглы и изменяет тропизм ткани ZIKV у макак-резусов [38].Кроме того, известно, что флавивирусы противодействуют передаче сигналов IFN типа I, воздействуя на ключевой компонент STAT2, чтобы реплицироваться и вызывать заболевание человека [24]. В отличие от людей, мыши устойчивы к этому механизму, поэтому ZIKV не может эффективно реплицироваться у иммунокомпетентных мышей. Наши наблюдения, что ZIKV быстро выводился из материнской циркуляции и постепенно снижался в материнской селезенке, предполагают непродуктивную инфекцию, при которой после первоначального заражения клеток-хозяев ZIKV может не реплицироваться или может реплицироваться, но впоследствии не может высвобождать инфекционный вирус.Неспособность установить длительную виремию и вызвать вертикальную передачу во время беременности отличается от обычного исхода для людей и нечеловеческих приматов. Однако наши данные предполагают, что воздействие ZIKV на эмбрион может быть результатом даже непродуктивной инфекции, что подчеркивает крайнюю чувствительность процесса беременности.

    Важно отметить, что даже в случае обнаруживаемой РНК ZIKV в тканях матери и плода реплицирующиеся инфекционные ZIKV не всегда выявляются в тканях матери или плода с помощью стандартного анализа бляшек, как сообщалось в исследовании беременных, не относящихся к человеку, приматов, где наблюдалось повреждение мозга плода [12 ].Используя двухэтапный усиленный анализ бляшек, в котором вирус предварительно амплифицируется в клетках насекомых перед выполнением стандартного анализа бляшек, мы успешно обнаружили инфекционные вирусы в плаценте маток, инфицированных на E9.5 с помощью 3,4 × 10 5 PFU ZIKV при 5 и 8 dpi (13% и 8% соответственно). Хотя частота обнаружения была низкой, это означает, что спорадическая или умеренная продуктивная инфекция все еще возможна даже у этих иммунокомпетентных беременных мышей. Примечательно, что наш расширенный анализ бляшек не смог обнаружить какой-либо инфекционный вирус в материнской селезенке при 5 и 8 dpi, что позволяет предположить, что компетентные к репликации инфекционные вирусы могут укрыться в плаценте, даже если они не могут сохраняться где-либо еще у иммунокомпетентных мышей.Вышеупомянутые ограничения могут повлиять на прямое применение наших результатов к инфекции человека. Тем не менее, наши результаты демонстрируют возможность даже непродуктивной инфекции ZIKV вызывать критические исходы для плода во время беременности и предоставляют полезную модель для исследования основных механизмов.

    Несмотря на присущие ограничения, наши данные иллюстрируют важность иммунокомпетентной модели беременности мышей. В предшествующих моделях на животных, где была продемонстрирована вертикальная передача и которая считается необходимой для неблагоприятного исхода для плода [6, 7, 19], использование блокады интерферона I типа или локализованная инокуляция непосредственно во влагалище или матку индуцировали устойчивую материнскую виремию и / или или прямой вирусный посев репродуктивных тканей проксимальнее зачатка.Полученная в результате глубокая репликация вируса в плаценте была вероятной причиной универсальной соответствующей эмбриональной инфекции. Безудержная вирусная инфекция в этих исследованиях, по-видимому, не позволила выявить другие детерминанты эмбрионального дистресса. Напротив, использование нами системно инфицированных иммунокомпетентных мышей позволило установить субмаксимальный уровень инфекции, достаточно тонкий, чтобы наблюдать ранее незамеченные нюансы патологии плаценты. Наше наблюдение, что неблагоприятный исход для плода может возникнуть даже при отсутствии вертикальной передачи, предполагает, что контрмеры ZIKV, которые могут эффективно блокировать вертикальную передачу, все же не могут гарантировать предотвращение неблагоприятного исхода для плода.

    Плацента образует решающий физический барьер между компартментами матери и плода, предотвращая передачу патогенов во время беременности. Он также способствует обмену газов, питательных веществ и отходов. Предыдущие мышиные модели продемонстрировали, что ZIKV был обнаружен в плаценте и приводил к инфекции и апоптозу трофобластов, повреждению сосудов, кровотечению и потере структуры плаценты [6, 7, 19]. Эта патология может нарушить функцию плацентарного барьера, что приведет к трансплацентарной передаче, а также нарушит обменную функцию, что приведет к плацентарной недостаточности.В случаях, когда мы наблюдали вирус в плаценте, мы также наблюдали, что антиген ZIKV локализован внутри нормальных и некротических эндотелиальных клеток лабиринта, что подтверждает возможность того, что инфекция ZIKV напрямую повреждает плаценту и снижает ее функцию кровообращения. Однако в большинстве случаев патологии плаценты и плода, наблюдаемой в нашей модели, наблюдалась нечастая или не поддающаяся измерению ассоциированная вирусная инфекция, что позволяет предположить, что функция плаценты может быть нарушена, несмотря на незначительный вирусный титр.В самом деле, модель мыши, инфицированная вирусом γ-герпеса 68 (MHV-68) на мышиной беременности, показала, что даже при отсутствии вертикальной передачи плод может пострадать от воспалительной реакции, вызванной вирусной инвазией плаценты [39].

    У иммунокомпетентных мышей можно предположить, что иммунный ответ матери (или даже плода) может вызвать побочное повреждение плаценты в процессе удаления вируса, что приведет к иммунопатологии и плацентарной недостаточности без детектируемого вируса.Впоследствии такое повреждение, в свою очередь, могло способствовать вирусному нарушению плацентарного барьера в тех случаях, когда материнская инфекция не была устранена. Было показано, что инфекция ZIKV вызывает противовирусный иммунный ответ как в клетках Хофбауэра человека, так и в плаценте мыши [19, 40]. Еще многое предстоит узнать о возможной защитной и пагубной роли врожденного и адаптивного иммунитета матери и плода против ZIKV во время беременности. В недавней публикации было высказано предположение, что передача сигналов IFN типа I плода может играть пагубную роль в опосредовании гибели плода после инфекции ZIKV, вызывая аномальное развитие плаценты [34].Используя сложную схему разведения и вагинальную инфекцию, он показал, что только эмбрионы с функциональной передачей сигналов IFN типа I резорбировались, несмотря на относительно более низкий титр вируса в их плаценте, в то время как их однопометники с дефектной передачей сигналов IFN типа I продолжали развиваться. Кроме того, он показал, что у концепта с функциональной передачей сигналов IFN типа I увеличивалось количество апоптозных клеток в плацентарном лабиринте и повышалась регуляция генов ответа на гипоксию у эмбриона. В соответствии с нашими наблюдениями, он поддерживает представление о том, что дисфункция плаценты, возникающая в результате врожденного иммунного ответа, является возможной причиной гибели плода, и вместе взятые могут дать представление о механизмах, лежащих в основе неблагоприятного исхода инфекции ZIKV для плода у иммунокомпетентных мышей.Однако вопрос о том, является ли плацентарная патология, опосредованная передачей сигналов IFN типа I, у иммунокомпетентных хозяев специфичной для инфекции ZIKV или является общим побочным повреждением после вирусной инфекции, требует дальнейшего исследования.

    Наиболее устойчивым патологическим признаком, связанным с аномалиями плода в нашем исследовании, была гиперплазия трофобласта и некроз эмбриональных эндотелиальных клеток в лабиринте, приводящий к потере эмбриональных кровеносных сосудов лабиринта и очаговый некроз в зоне соединения. В исследовании, не связанном с инфекцией, было показано, что гиперплазия трофобластов в лабиринте приводит к глобальному нарушению лабиринта и сосудистой архитектуры и, в конечном итоге, к гибели плода [41].Наши данные свидетельствуют о том, что гиперплазия трофобластов не вызвана напрямую вирусной инфекцией, поскольку плаценты от маток, инфицированных на E9.5, демонстрировали гиперплазию трофобластов, в то время как плаценты от маток, инфицированных на E12.5, не имели, несмотря на высокие уровни плацентарной РНК ZIKV. Хотя прямая связь между гиперплазией трофобласта и аномалией / гибелью плода еще предстоит установить, наше исследование четко указывает на то, что патология плаценты может вносить вклад в связанный с ZIKV неблагоприятный исход для плода, независимо от прямого присутствия вируса в развивающихся эмбрионах у иммунокомпетентных мышей.

    Разрушительное воздействие инфекции ZIKV во время беременности на развитие плода ясно показывает, что модель беременности необходима для доклинических испытаний вакцин и терапевтических средств. О защитной эффективности экспериментальных вакцин против ZIKV-индуцированной гибели плода сообщалось на модели беременности мышей с использованием блокады IFN I типа [42]. Наша модель иммунокомпетентной беременности может предоставить дополнительную методологически простую и высокопроизводительную платформу для доклинических испытаний. Однако, поскольку мы продемонстрировали, что отсутствие обнаруживаемого вируса не обязательно предсказывает здоровье плода, а рождение детенышей не гарантирует их выживания, для подтверждения здоровья или выживаемости новорожденных необходим более длительный постнатальный последующий мониторинг в обеих моделях.Более того, было показано, что ZIKV может сохраняться на низких уровнях в нескольких анатомически разделенных областях, включая центральную нервную систему, репродуктивные тракты или жидкости организма, до нескольких недель [43–45], что может быть трудно обнаружить с помощью стандартной лучевой терапии. -ПЦР или анализ бляшек. Точно так же ткань плаценты может служить убежищем, где ZIKV может избежать полного выведения и оставаться на следовых уровнях. Действительно, наша способность обнаруживать репликационно-компетентный вирус при 5 dpi в плаценте с использованием расширенного анализа бляшек, несмотря на его отсутствие в селезенке, подразумевает, что плацента может быть уникально восприимчивым убежищем для ZIKV по сравнению с другими тканями.Более того, глубокие пагубные последствия инфекции или иммунитета у плода при оставлении матери, по существу, щадящей, демонстрируют исключительную чувствительность плацентарно-фетальной среды к инфекции. Следовательно, очень важно определить, не только ли вакцина или лекарство успешно защищает от явного заболевания / инфекции у взрослых, но и предотвращает последствия для плода во время беременности.

    Материалы и методы

    Заявление об этике

    Все исследования на животных проводились в соответствии с Руководством по уходу и использованию лабораторных животных Национального института здоровья и одобрены Комитетом по уходу и использованию животных Института Трюдо (протокол IACUC № 16–009).

    Вирусы, клетки и титрование

    Штамм PRVABC59 ZIKV Puerto Rico был получен через BEI Resources, NIAID, NIH (NR-50240).Клетки Vero (эпителиальные клетки почек африканской зеленой мартышки) были приобретены из Американской коллекции типовых культур (ATCC CCL-81) и сохранены в DMEM с добавлением 10% инактивированного нагреванием FBS, 2 мМ L-глутамина, 1 мМ пенициллин-стрептомицин и 0,3% бикарбоната натрия. при 37 ° C и 5% CO 2 .

    исходных клеток ZIKV размножали с низким числом пассажей клеток Vero, инфицированных при множественности инфицирования (MOI) 0,1. Супернатанты культур как от ложно-инфицированных, так и от ZIKV-инфицированных клеток собирали через 4 дня после заражения и осветляли центрифугированием при 3800 g в течение 15 минут при 4 ° C.Фетальную бычью сыворотку добавляли до конечной концентрации 20% (об. / Об.) И аликвоты хранили при -80 ° C. Инфекционный вирусный титр исходных веществ определяли с помощью анализа бляшек на монослоях клеток Vero. Вкратце, клетки Vero высевали в 6-луночный планшет для достижения слияния через 18-24 часа. Клетки инфицировали 1 мл серийных 10-кратных разведений супернатанта, приготовленного в чистой среде DMEM в течение 1 ч при 37 ° C. Затем клетки покрывали средой карбоксиметилцеллюлозы (0,75% в клеточной среде Vero) и инкубировали в течение 5 дней при 37 ° C.Клетки фиксировали метанолом и окрашивали кристаллическим фиолетовым для визуализации бляшек. Было выбрано наиболее подходящее разведение для определения количества инфекционного вируса в стапелях.

    Мыши и инфекции

    Самок мышей C57BL / 6J были приобретены в лаборатории Джексона (Бар-Харбор, штат Мэн). Мышей готовили для спаривания по времени в возрасте 8–12 недель, и день, когда была обнаружена пробка, рассматривался как 0,5 дня беременности (т.е. E0,5).

    В указанные гестационные дни беременных мышей слегка анестезировали изофлураном и инфицировали 3.4 × 10 4 , 1 × 10 5 или 3,4 × 10 5 БОЕ ZIKV в объеме 100 мкл внутривенным (ретроорбитальным) путем. Контрольных мышей оставляли необработанными или инокулировали 100 мкл супернатанта клеточной культуры Vero (имитация инфекции) или 3,4 × 10 5 БОЕ эквивалента инактивированного нагреванием или предварительно обработанного ZIKV. Некоторым беременным мышам давали возможность родить, а самок и новорожденных обследовали в течение 24 часов после рождения.

    Для приготовления инактивированного нагреванием ZIKV исходный вирусный материал нагревали до 60 ° C в течение 1 часа.Для предварительной обработки инокулята перед инфицированием исходный вирусный материал инкубировали с 0,5 мг / мл нейтрализующего мАт ZK-67 против ZIKV [33] (Absolute Antibody Ltd, Оксфорд, Великобритания), 0,5 мг / мл изотипического контроля мышиного IgG2a (клон C1.18.4; BioXCell, West Lebanon, NH) или 1: 4 ZIKV-иммунной сыворотки на 3,4 × 10 5 БОЕ при 37 ° C в течение 1 часа. Эквивалент 3,4 × 10 5 БОЕ предварительно обработанного ZIKV вводили внутривенно беременным мышам. Жизнеспособность и инфекционность ZIKV после обработки подтверждали анализом бляшек.

    Для получения сыворотки фазы выздоровления для пассивного переноса самок мышей C57BL / 6J в возрасте> 10 недель внутривенно инфицировали 2 × 10 5 БОЕ ZIKV в день 0 и день 35, а образцы сыворотки собирали на 50 день. , объединяют, разделяют на аликвоты и хранят при -80 ° C. Контрольную сыворотку собирали у неинфицированных наивных мышей того же возраста. Беременным мышам на ст. E8.5 внутрибрюшинно вводили 50 мкл иммунной сыворотки, 250 мкл наивной сыворотки или физиологического раствора в общем объеме 250 мкл.Затем мышей внутривенно инфицировали 3,4 × 10 5 БОЕ ZIKV. Контрольным мышам прививали 100 мкл супернатанта клеточной культуры Vero (имитация инфекции).

    Измерение вирусной нагрузки

    ZIKV-инфицированных беременных мышей умерщвляли в указанные сроки после заражения. Селезенку, печень, мозг, почки, а также эмбрионы и соответствующие им плаценты собирали, мгновенно замораживали в жидком азоте или гомогенизировали шариками из нержавеющей стали в 1 мл DMEM с добавлением 2% термоинактивированного FBS с использованием прибора TissueLyzer II. (QIAGEN).Все образцы хранили при -80 ° C до очистки РНК или титрования вирусов. Некоторые образцы плаценты и эмбриона фиксировали в 10% нейтральном забуференном формалине для дальнейшего гистологического анализа.

    Для измерения инфекционных вирусных частиц гомогенаты тканей размораживали и осветляли центрифугированием при 2000 g в течение 10 минут при 4 ° C. Вирусную нагрузку определяли с помощью анализа бляшек на клетках Vero, как описано выше. Для измерения уровней РНК ZIKV образцы замороженных тканей разрушали и гомогенизировали в буфере RLT (QIAGEN), содержащем β-меркаптоэтанол (β-ME), с использованием гомогенизатора Tissuemiser (Fisher Scientific), и общую РНК очищали с использованием RNeasy Mini Kit (QIAGEN) в соответствии с инструкции производителя.Суммарную РНК подвергали обратной транскрипции в кДНК с использованием случайных гексамеров, и уровни РНК ZIKV определяли количественной ПЦР в реальном времени на системе 7500 Fast Real-time PCR System (Applied Biosystems) с использованием стандартных условий цикла. Набор ZIKV-специфических праймеров и зонд были ранее опубликованы [46]: прямой, 5′-CCGCTGCCCAACACAAG-3 ‘, обратный 5′-CCACTAACGTTCTTTTGCAGACAT-3’, зонд 5 ‘- / 56-FAM / AGCCTACCT / ZEN / TGACAAGCAGTCAGACACTCFAQ / 3 / -3 ‘(Комплексные ДНК-технологии). Уровни продукта ПЦР были нормализованы по гену домашнего хозяйства GAPDH: прямой 5’-CTCGTCCCGTAGACAAAATGG-3 ’, обратный 5’-AATCTCCACTTTGCCACTGCA-3’ и зонд CGGATTTGGCCGTATTGGGCG (Integrated DNA Technologies).Уровни РНК ZIKV интерполировали по стандартным кривым, полученным путем разбавления РНК из неинфицированной ткани с добавлением известного количества ZIKV (как определено анализом бляшек) и выражали в эквиваленте БОЕ на грамм ткани.

    Кровь собирали у инфицированных мышей, давали ей свернуться при 37 ° C, сыворотку отделяли центрифугированием при 10600 g в течение 10 минут и хранили при -80 ° C. Суммарную РНК в 50 мкл сыворотки очищали с использованием мини-набора для вирусной РНК QIAmp (QIAGEN). Уровни РНК ZIKV определяли с помощью 1-этапной мастер-смеси TaqMan Fast Virus (Applied Biosystems), интерполировали по стандартной кривой, построенной с использованием известных количеств ZIKV, и выражали в эквиваленте БОЕ на мл сыворотки.

    Гистологическое и иммуногистохимическое окрашивание

    Ткани фиксировали в 10% нейтральном забуференном формалине, заливали парафином, делали срезы и окрашивали гематоксилином и эозином. Для иммуногистохимического окрашивания ZIKV 5-микронные срезы залитых парафином тканей промывали несколькими сменами ксилола для удаления парафина и регидратировали с помощью этанола пониженного содержания (абсолютное до 70%) с последующей деионизированной водой. Эндогенную щелочную фосфатазу блокировали с помощью Bloxall (Vector Labs) в течение 10 мин.Ткани промывали PBS, содержащим 0,1% Tween 20, блокировали 5% нормальной мышиной сывороткой (Jackson Immunoresearch) в течение 30 минут, а затем инкубировали с первичным Ab (антитело к белку оболочки вируса Зика, GeneTex), разведенным в PBS с 0,1% Tween 20. и 5% нормальной мышиной сыворотки в течение 2 ч при комнатной температуре. После промывания ткани инкубировали с щелочной фосфатазой против кроличьего IgG (Vector Labs) в течение 30 минут, затем проявляли с использованием субстрата щелочной фосфатазы Vector Red (Vector Labs) и окрашивали гематоксилином (Fisher).Слайды получали с помощью микроскопа Nikon Eclipse Ci и цифровой камеры Nikon SPOT 2. Первичное антитело, используемое для окрашивания оболочечного белка ZIKV, было подтверждено специфическим окрашиванием инфицированных ZIKV клеток Vero (S2, фиг.). Неинфицированные и инфицированные ZIKV клетки Vero обрабатывали в виде осадка клеток, заливали в парафин и окрашивали теми же реагентами, что и ткани, которые использовали в качестве отрицательного и положительного контроля, соответственно, и включали в каждый протокол окрашивания. Ткани неинфицированных мышей также использовали в качестве отрицательного контроля.Гистологические препараты были просмотрены сертифицированным ветеринарным патологом.

    Статистика

    Статистический анализ выполняли с использованием Prism 5 (программное обеспечение GraphPad). Данные ZIKV РНК сравнивали с помощью непараметрических критериев Манна-Уитни. Уровням РНК ZIKV, которые упали ниже предела обнаружения наших анализов, были произвольно присвоены значения на 0,2 log ниже предела обнаружения для непараметрического статистического анализа. Данные о непредвиденных обстоятельствах были проанализированы с помощью точного теста Фишера с использованием чисел в каждой группе.Ассоциацию / диссоциацию анализировали с помощью теста хи-квадрат. Данные о весе анализировали с помощью теста Student t . * p <0,5, ** p <0,01, *** p <0,001, **** p <0,0001; нс, не имеет значения.

    Дополнительная информация

    S1 Рис. ZIKV-инфекция беременных мышей C57BL / 6J приводит к задержке роста плода и снижению веса.

    Беременные самки на ст. E9.5 были оставлены неинфицированными (неинфицированными), инокулированы супернатантом культуры клеток Vero (Mock), 3,4 × 10 5 БОЕ-эквивалент инактивированного нагреванием ZIKV (Inact.ZIKV) или инфицировали 3,4 × 10 5 БОЕ ZIKV, как описано на фиг. 1. Мышей умерщвляли с разрешением 8 dpi. ( A ) Репрезентативные изображения эмбрионов E17.5. Остальные эмбрионы, несущие ZIKV-инфицированные самки, демонстрировали ограничение роста или полностью резорбировались (плацентарные остатки). ( B ) Вес эмбриона. Процент указывает на эмбрионы, подвергшиеся полной резорбции. Показанные данные являются медианными с межквартильным размахом. (нс, не значимо; * p <0,05; **** p <0.0001 по сравнению с неинфицированной группой по критерию Манна-Уитни). Данные объединены из 5 независимых экспериментов.

    https://doi.org/10.1371/journal.ppat.1006994.s001

    (TIF)

    S2 Рис. Подтверждение окрашивания белка оболочки ZIKV.

    Клетки Vero выращивали почти до конфлюэнтности и инфицировали ZIKV при MOI 0,1. Неинфицированные и инфицированные ZIKV клетки Vero собирали через 3 дня после заражения и осаждали центрифугированием при 3800 g в течение 15 минут при 4 ° C. Среду аспирировали, и к осадку клеток осторожно добавляли нейтральный забуференный формалин и давали возможность закрепиться в течение по меньшей мере 24 часов.После фиксации осадок неинфицированных и инфицированных клеток осторожно извлекали из фиксатора и обрабатывали вместе с образцами тканей в парафиновый воск. Из каждой гранулы вырезали срезы размером пять микрон. Эти подготовленные слайды окрашивали теми же реагентами, что и ткани, и использовали в качестве отрицательного (незараженного) и положительного (инфицированного) контроля, которые были включены в каждый протокол окрашивания. Белок оболочки ZIKV (красный) был обнаружен в инфицированных, но не незараженных клетках Vero. Масштабная линейка 25 мкм.

    https: // doi.org / 10.1371 / journal.ppat.1006994.s002

    (TIF)

    Благодарности

    Мы благодарим докторов наук. Тимоти Энди, Марку Полхемусу, Дэну Баруху, Лоуренсу Джонсону, Уильяму Рейли и Майклу Вайди за полезное обсуждение и критическое прочтение этой рукописи, доктору Лоуренсу Джонсону за помощь в статистическом анализе и доктору Дэну Баруху за предоставление акций ZIKV. Мы также благодарим Дерека Бернаки и Келси Трэвис за техническую помощь с двухэтапным улучшенным анализом налета, а также сотрудников животноводческих комплексов Института Трюдо за своевременное спаривание и уход за мышами, использованными в этих исследованиях.

    Список литературы

    1. 1. Lazear HM, Diamond MS. Вирус Зика: новые клинические синдромы и его появление в западном полушарии. J Virol. 2016; 90 (10): 4864–75. pmid: 26962217.
    2. 2. Петерсен Л. Р., Джеймисон Д. Д., Пауэрс А. М., Хонейн Массачусетс. Зика Вирус. N Engl J Med. 2016; 374 (16): 1552–63. pmid: 27028561.
    3. 3. Андерсон КБ, Томас SJ, Энди Т.П. Появление вируса Зика: обзорный обзор. Ann Intern Med. 2016; 165 (3): 175–83. pmid: 27135717.
    4. 4. Brasil P, Pereira JP Jr., Moreira ME, Ribeiro Nogueira RM, Damasceno L, Wakimoto M, et al. Инфекция вирусом Зика у беременных в Рио-де-Жанейро. N Engl J Med. 2016; 375 (24): 2321–34. pmid: 26943629.
    5. 5. Расмуссен С.А., Джеймисон Д.Д., Хонейн М.А., Петерсен Л.Р. Вирус Зика и врожденные пороки — анализ доказательств причинно-следственной связи. N Engl J Med. 2016; 374 (20): 1981–7. pmid: 27074377.
    6. 6. Майнер Дж. Дж., Цао Б., Говеро Дж., Смит А. М., Фернандес Э., Кабрера О. Н. и др.Инфекция вирусом Зика во время беременности у мышей вызывает повреждение плаценты и гибель плода. Клетка. 2016; 165 (5): 1081–91. pmid: 27180225.
    7. 7. Йоки Л.Дж., Варела Л., Ракиб Т., Хури-Ханольд В., Финк С.Л., Штутц Б. и др. Вагинальное воздействие вируса Зика во время беременности приводит к инфицированию головного мозга плода. Клетка. 2016; 166 (5): 1247–56 e4. pmid: 27565347.
    8. 8. Ли С, Сюй Д, Е Цюй, Хун С., Цзян И, Лю Х и др. Вирус Зика нарушает развитие нервных предшественников и приводит к микроцефалии у мышей.Стволовая клетка. 2016; 19 (5): 672. pmid: 27814481.
    9. 9. Wu KY, Zuo GL, Li XF, Ye Q, Deng YQ, Huang XY и др. Вертикальная передача вируса Зика, нацеленная на клетки радиальной глии, влияет на развитие коры головного мозга мышей-потомков. Cell Res. 2016; 26 (6): 645–54. pmid: 27174054.
    10. 10. Хуанг В.К., Абрахам Р., Шим Б.С., Чхве Х., Пейдж Д.Т. Инфекция вирусом Зика в период максимального роста мозга вызывает микроцефалию и апоптоз кортикоспинальных нейронов у мышей дикого типа.Научный доклад 2016; 6: 34793. pmid: 27713505.
    11. 11. Adams Waldorf KM, Nelson BR, Stencel-Baerenwald JE, Studholme C, Kapur RP, Armistead B, et al. Врожденная инфекция, вызванная вирусом Зика, как скрытая патология с потерей нейрогенной продукции в мозге плода. Nat Med. 2018; 24 (3): 368–74. Epub 2018/02/06. pmid: 29400709.
    12. 12. Adams Waldorf KM, Stencel-Baerenwald JE, Kapur RP, Studholme C, Boldenow E, Vornhagen J, et al. Поражения головного мозга плода после подкожной инокуляции вируса Зика у беременных нечеловеческих приматов.Nat Med. 2016; 22 (11): 1256–9. pmid: 27618651.
    13. 13. Hirsch AJ, Roberts VHJ, Grigsby PL, Haese N, Schabel MC, Wang X и др. Инфекция вируса Зика у беременных макак-резус вызывает дисфункцию плаценты и иммунопатологию. Nat Commun. 2018; 9 (1): 263. Epub 2018.01.19. pmid: 29343712.
    14. 14. Альварадо М.Г., Шварц Д.А. Инфекция вирусом Зика при беременности, микроцефалии и здоровье матери и плода: что мы думаем, что мы знаем и что мы думаем, что знаем. Arch Pathol Lab Med.2017; 141 (1): 26–32. pmid: 27636525.
    15. 15. Шварц Д.А. Происхождение и появление вируса Зика, новейшей TORCH-инфекции: что старое, то снова новое. Arch Pathol Lab Med. 2017; 141 (1): 18–25. pmid: 27763793.
    16. 16. Coyne CB, Lazear HM. Вирус Зика — снова зажигает ФАКЕЛ. Nat Rev Microbiol. 2016; 14 (11): 707–15. pmid: 27573577.
    17. 17. Brasil P, Calvet GA, Siqueira AM, Wakimoto M, de Sequeira PC, Nobre A, et al. Вспышка вируса Зика в Рио-де-Жанейро, Бразилия: клиническая характеристика, эпидемиологические и вирусологические аспекты.PLoS Negl Trop Dis. 2016; 10 (4): e0004636. pmid: 27070912.
    18. 18. Cugola FR, Fernandes IR, Russo FB, Freitas BC, Dias JL, Guimaraes KP и др. Бразильский штамм вируса Зика вызывает врожденные дефекты в экспериментальных моделях. Природа. 2016; 534 (7606): 267–71. pmid: 27279226.
    19. 19. Vermillion MS, Lei J, Shabi Y, Baxter VK, Crilly NP, McLane M и др. Внутриутробная инфекция вирусом Зика беременных иммунокомпетентных мышей моделирует трансплацентарную передачу и неблагоприятные перинатальные исходы.Nat Commun. 2017; 8: 14575. pmid: 28220786.
    20. 20. Xavier-Neto J, Carvalho M, Pascoalino BD, Cardoso AC, Costa AM, Pereira AH и др. Гидроцефалия и артрогрипоз в модели тератогении ZIKA на иммунокомпетентных мышах: исследование развития. PLoS Negl Trop Dis. 2017; 11 (2): e0005363. pmid: 28231241.
    21. 21. Майсорекар И.Ю., Diamond MS. Моделирование вирусной инфекции Зика во время беременности. N Engl J Med. 2016; 375 (5): 481–4. pmid: 27433842.
    22. 22. Моррисон TE, Diamond MS.Животные модели вирусной инфекции Зика, патогенез и иммунитет. J Virol. 2017; 91 (8). pmid: 28148798.
    23. 23. Павитвар С.С., Дхар С., Тивари С., Оджа С.Р., Лапьер Дж., Мартинс К. и др. Обзор текущего состояния патогенеза вируса Зика и исследований, связанных с животными. J Neuroimmune Pharmacol. 2017. pmid: 28444557.
    24. 24. Грант А, Пония С.С., Трипати С., Баласубраманиам В., Миорин Л., Суриссо М. и др. Вирус Зика нацелен на человеческий STAT2 для подавления передачи сигналов интерферона типа I.Клеточный микроб-хозяин. 2016; 19 (6): 882–90. pmid: 27212660.
    25. 25. Lazear HM, Govero J, Smith AM, Platt DJ, Fernandez E, Miner JJ и др. Мышиная модель патогенеза вируса Зика. Клеточный микроб-хозяин. 2016; 19 (5): 720–30. pmid: 27066744.
    26. 26. Росси С.Л., Теш Р.Б., Азар С.Р., Муруато А.Е., Хэнли К.А., Огюст А.Дж. и др. Характеристика новой модели мышей для изучения вируса Зика. Am J Trop Med Hyg. 2016; 94 (6): 1362–9. pmid: 27022155.
    27. 27. Алиота М.Т., Кейн Э.А., Уокер Э.С., Ларкин К.Э., Камачо Э., Осорио Дж. Э.Характеристика летальной инфекции вируса Зика у мышей AG129. PLoS Negl Trop Dis. 2016; 10 (4): e0004682. pmid: 27093158.
    28. 28. Halai UA, Nielsen-Saines K, Moreira ME, Sequeira PC, Pereira Junior JP, Zin AA и др. Тяжесть материнского заболевания, вызванного вирусом Зика, вирусная нагрузка, предшествующие антитела денге и их связь с исходами родов. Clin Infect Dis. 2017. pmid: 28535184.
    29. 29. Джаггер Б.В., Майнер Дж.Дж., Цао Б., Арора Н., Смит А.М., Ковач А. и др. Гестационная стадия и передача сигналов IFN-лямбда регулируют инфекцию ZIKV в утробе матери.Клеточный микроб-хозяин. 2017; 22 (3): 366–76 e3. Epub 2017/09/15. pmid: 28

      5.
    30. 30. Йоханссон М.А., Миер-и-Теран-Ромеро Л., Рифхус Дж., Гильбоа С.М., Хиллс С.Л. Зика и риск микроцефалии. N Engl J Med. 2016; 375 (1): 1–4. pmid: 27222919.
    31. 31. Мело А.С., Агиар Р.С., Аморим М.М., Арруда МБ, Мело Ф.О., Рибейро С.Т. и др. Врожденная инфекция, вызванная вирусом Зика: за пределами неонатальной микроцефалии. JAMA Neurol. 2016; 73 (12): 1407–16. pmid: 27695855.
    32. 32. Пачеко О., Белтран М., Нельсон Калифорния, Валенсия Д., Толоса Н., Фарр С.Л. и др.Болезнь, вызванная вирусом Зика, в Колумбии — предварительный отчет. N Engl J Med. 2016. pmid: 27305043.
    33. 33. Zhao H, Fernandez E, Dowd KA, Speer SD, Platt DJ, Gorman MJ, et al. Структурные основы защиты антител, специфичных к вирусу Зика. Клетка. 2016. 166 (4): 1016–27. pmid: 27475895.
    34. 34. Йоки Л.Дж., Хурадо К.А., Арора Н., Миллет А., Ракиб Т., Милано К.М. и др. Интерфероны типа I провоцируют гибель плода после инфицирования вирусом Зика. Sci Immunol. 2018; 3 (19). pmid: 29305462.
    35. 35.Нгуен С.М., Энтони К.М., Дадли Д.М., Кон С., Симмонс Х.А., Вулф Б. и др. Высокоэффективная передача вируса Зика от матери к плоду беременных макак-резус. PLoS Pathog. 2017; 13 (5): e1006378. pmid: 28542585.
    36. 36. Стайер Л.М., Кент К.А., Олбрайт Р.Г., Беннетт С.Дж., Крамер Л.Д., Бернард К.А. Комары инокулируют высокие дозы вируса Западного Нила, когда зондируют живых хозяев и питаются ими. PLoS Pathog. 2007. 3 (9): 1262–70. pmid: 17941708.
    37. 37. Кокс Дж., Мота Дж., Сукуполви-Петти С., Даймонд М.С., Рико-Гессе Р.Доставка вируса денге укусом комара усиливает иммуногенность и патогенез у гуманизированных мышей. J Virol. 2012. 86 (14): 7637–49. pmid: 22573866.
    38. 38. Дадли Д.М., Ньюман С.М., Лалли Дж., Стюарт Л.М., Кениг М.Р., Вейлер А.М. и др. Заражение через укус комара изменяет тропизм к тканям вируса Зика и кинетику репликации у макак-резусов. Nat Commun. 2017; 8 (1): 2096. pmid: 29235456.
    39. 39. Карденас I, Означает RE, Aldo P, Koga K, Lang SM, Booth CJ, et al. Вирусная инфекция плаценты приводит к воспалению плода и сенсибилизации к бактериальным продуктам, предрасполагающим к преждевременным родам.J Immunol. 2010. 185 (2): 1248–57. pmid: 20554966.
    40. 40. Quicke KM, Bowen JR, Johnson EL, McDonald CE, Ma H, O’Neal JT, et al. Вирус Зика поражает плацентарные макрофаги человека. Клеточный микроб-хозяин. 2016; 20 (1): 83–90. pmid: 27247001.
    41. 41. Венцель П.Л., Ву Л., де Брюин А., Чонг Дж.Л., Чен В.Й., Дуреска Г. и др. Rb имеет решающее значение для популяции стволовых клеток ткани млекопитающих. Genes Dev. 2007. 21 (1): 85–97. pmid: 17210791.
    42. 42. Richner JM, Jagger BW, Shan C, Fontes CR, Dowd KA, Cao B, et al.Защита от врожденных заболеваний, вызванных вирусом Зика, с помощью вакцин. Клетка. 2017; 170 (2): 273–83 e12. pmid: 28708997.
    43. 43. Эйд М., Аббинк П., Ларокка Р.А., Бойд М., Нитьянандам Р., Нанаяккара О. и др. Персистенция вируса Зика в центральной нервной системе и лимфатических узлах макак-резусов. Клетка. 2017; 169 (4): 610–20 e14. pmid: 28457610.
    44. 44. Baud D, Musso D, Vouga M, Alves MP, Vulliemoz N. Вирус Зика: новая угроза репродукции человека. Am J Reprod Immunol.2017; 77 (2). pmid: 27966802.
    45. 45. Паз-Бейли Г., Розенберг Е.С., Дойл К., Муньос-Джордан Дж., Сантьяго Г.А., Кляйн Л. и др. Устойчивость вируса Зика в жидкостях организма — предварительный отчет. N Engl J Med. 2017. pmid: 28195756.
    46. 46. Lanciotti RS, Kosoy OL, Laven JJ, Velez JO, Lambert AJ, Johnson AJ и др. Генетические и серологические свойства вируса Зика, связанные с эпидемией, штат Яп, Микронезия, 2007. Emerg Infect Dis. 2008. 14 (8): 1232–9. pmid: 18680646.

    Ограничение внутриутробного развития (ЗВУР): этиология и диагностика

  • 1.

    Американский колледж акушеров и гинекологов. Ограничение внутриутробного развития. Практический бюллетень № 12, 2000, Вашингтон, округ Колумбия. http://www.acog.org. По состоянию на 25 декабря 2012 г.

  • 2.

    Королевский колледж акушеров и гинекологов. Http://www.rcog.org.uk/womens-health/investigation-and-management-small-gestational-age-fetus-green- топ-31. Опубликовано 1 ноября 2002 г. Проверено 25 декабря 2012 г.

  • 3.

    Chauhan SP, Magann EF. Скрининг на задержку роста плода.Clin Obstet Gynecol. 2006; 49: 284–94.

    PubMed Статья Google ученый

  • 4.

    •• Ривз С., Галан Х.Л. Ограничение роста плода. В: Бергелла V, редактор. Рекомендации для матери и плода, основанные на фактических данных. 2-е изд. Лондон: Informa Health Care; 2012. с. 329–44. Превосходное свидетельство на основе главы IUGR , легко читаемый формат с таблицами и алгоритмами .

    Google ученый

  • 5.

    Gardosi J. Клинические стратегии для улучшения выявления задержки роста плода. Clin Perinatol. 2011; 38: 21–31.

    PubMed Статья Google ученый

  • 6.

    Де Онис М., Блосснер М., Виллар Дж. Уровни и модели задержки внутриутробного развития в развивающихся странах. Eur J Clin Nutr. 1998; 52 (Дополнение 1): S5 – S15.

    PubMed Google ученый

  • 7.

    Ott WJ. Диагноз измененный рост плода. Obstet Gynecol Clin North Am. 1988. 15: 237–63.

    PubMed CAS Google ученый

  • 8.

    Клауссон Б., Гардози Дж., Фрэнсис А. и др. Перинатальный исход при рождении с SGA определяется индивидуализированными стандартами массы тела при рождении по сравнению с популяционными. BJOG. 2001; 108: 830–4.

    PubMed CAS Google ученый

  • 9.

    Ганьон Р., Ван де Хоф М.Использование фетального допплера в акушерстве. J Obstet Gynecol Can. 2003. 25 (7): 601–7.

    Google ученый

  • 10.

    Американский колледж акушеров и гинекологов. Мнение комитета ACOG. Применение допплеровской велосиметрии дородовой пупочной артерии при ограничении внутриутробного развития. Номер 188, октябрь 1997 г. (заменяет № 116, ноябрь 1992 г.). Комитет по акушерской практике. Int J Gynaecol Obstet. 1997; 59: 269–70.

    Артикул Google ученый

  • 11.

    Winick M. Недоедание плода. Clin Obstet Gynecol. 1970. 13 (3): 526–41.

    PubMed Статья CAS Google ученый

  • 12.

    • Башат А.А., Галан Х.Л., Габбе С.Г. Ограничение внутриутробного развития. В: Габби С.Г., Нейбил Дж. Р., Симпсон Дж. Л., редакторы. Акушерство при нормальной и проблемной беременности. Филадельфия: Эльзевир; 2012. с. 706–41. Отлично в углубленный обзор патофизиологии , факторы риска и оценка IUGR .

    Глава Google ученый

  • 13.

    Villar J, Belizan JM. Фактор времени в патофизиологии синдрома задержки внутриутробного развития. Obstet Gynecol Surv. 1982. 37 (8): 499–506.

    PubMed Статья CAS Google ученый

  • 14.

    Даше Дж., Макинтайр Д., Лукас М. и др. Влияние симметричного и асимметричного роста плода на исход беременности.Obstet Gynecol. 2000; 1996 (3): 321–7.

    Артикул Google ученый

  • 15.

    Дэвид К., Габриэлли С., Пилу Г. и др. Отношение окружности головы к окружности живота: переоценка. Ультразвуковой акушерский гинекол. 1995. 5 (4): 256–9.

    PubMed Статья CAS Google ученый

  • 16.

    Алфиревич З., Стампалия Т., Gyte GML. Допплерография плода и пуповины при беременности высокого риска.Кокрановская база данных Syst Rev.2010; 1: CD007529.

    PubMed Google ученый

  • 17.

    Чен Х.Й., Чаухан С.П., Уорд Т.С. и др. Аберрантный рост плода и ранняя, поздняя и постнеонатальная смертность: анализ рождений в Милуоки, 1996–2007 гг. Am J Obstet Gynecol. 2011; 204: 261. e1 – e261, e10.

    PubMed Google ученый

  • 18.

    Гардози Дж., Клауссон Б., Фрэнсис А. Значение индивидуализированных центилей при оценке риска перинатальной смертности, связанного с рождением и размерами матери.Br J Obstet Gynaecol. 2009; 116: 1356–63.

    Артикул CAS Google ученый

  • 19.

    фон Бекерат А.К., Коллманн М., Ротки-Фаст С. и др. Перинатальные осложнения и отдаленные результаты неврологического развития младенцев с задержкой внутриутробного развития. Am J Obstet Gynecol. 2013; 208 (2): 130.e1–6.

    Артикул Google ученый

  • 20.

    Bernstein IM, Horbar JD, et al.Заболеваемость и смертность новорожденных с очень низкой массой тела при рождении с задержкой внутриутробного развития. Сеть Вермонта Оксфорда. Am J Obstet Gynecol. 2000. 182: 198–206.

    PubMed Статья CAS Google ученый

  • 21.

    Макинтайр Д.Д., Блум С.Л., Кейси Б.М. и др. Вес при рождении в зависимости от заболеваемости и смертности новорожденных. N Engl J Med. 1999; 340: 1234–8.

    PubMed Статья CAS Google ученый

  • 22.

    Pallotto E, Kilbride H. Перинатальные исходы и более поздние последствия ограничения внутриутробного развития. Clin Obstet Gynecol. 2006. 49 (2): 257–69.

    PubMed Статья Google ученый

  • 23.

    Анжелика Д., Джованни О., Вассилиос Ф. Физиопатология задержки внутриутробного развития: от классических данных к метаболомике. J Maternal-Fetal Neonatal Med. 2012; 25 (S5): 13–8.

    Артикул Google ученый

  • 24.

    Баркер Д. Последствия задержки роста плода для взрослых. Clin Obstet Gynecol. 2006. 49 (2): 270–83.

    PubMed Статья Google ученый

  • 25.

    Хендрикс Н., Бергелла В. Неплацентарные причины задержки внутриутробного развития. Семин Перинатол. 2008. 32 (3): 161–5.

    PubMed Статья Google ученый

  • 26.

    Ли К.С., Фергюсон Р.М., Корпус М, Гартнер Л.М.Возраст матери и частота рождения ребенка с низкой массой тела в срок: популяционное исследование. Am J Obstet Gynecol. 1988. 158 (1): 84–9.

    PubMed CAS Google ученый

  • 27.

    Олдос МБ, Эдмонсон МБ. Возраст матери при первых родах и риск низкой массы тела при рождении и преждевременных родов в штате Вашингтон. ДЖАМА. 1993. 270 (21): 2574–5.

    PubMed Статья CAS Google ученый

  • 28.

    Стробино Д.М., Энсмингер М.Э., Ким Ю.Дж., Нанда Дж. Механизмы материнских возрастных различий в массе тела при рождении. Am J Epidemiol. 1995. 142 (5): 504–14.

    PubMed CAS Google ученый

  • 29.

    Вен С.В., Голденберг Р.Л., Каттер Г.Р. и др. Задержка внутриутробного развития и преждевременные роды: факторы внутриутробного риска у малоимущего населения. Am J Obstet Gynecol. 1990; 162: 213–8.

    PubMed CAS Google ученый

  • 30.

    Бергелла В. Профилактика повторяющейся задержки роста плода. Obstet Gynecol. 2007. 110 (4): 904–12.

    PubMed Статья Google ученый

  • 31.

    Анатов АН. Дети, родившиеся во время блокадного Ленинграда в 1942 году. Педиатр. 1947; 30: 250–9.

    Артикул Google ученый

  • 32.

    Smith CA. Влияние недостаточного питания матери на новорожденного в Голландии (1944–1945).J Pediatr. 1947; 30: 229–43.

    PubMed Статья CAS Google ученый

  • 33.

    Галан Х.Л., Ригано С., Радаэлли Т. и др. Уменьшение подкожной массы, но не мышечной массы, у нормальных плодов в Денвере, Колорадо. Am J Obstet Gynecol. 2001; 185: 839–44.

    PubMed Статья CAS Google ученый

  • 34.

    Mortola JP, Frappell PB, Aguero L, Armstrong K.Вес при рождении и высота: исследование в перуанских сообществах. J Pediatr. 2000; 136: 324–9.

    PubMed Статья CAS Google ученый

  • 35.

    Kametas NA, McAuliffe F, Krampl E, et al. Сердечная деятельность матери во время беременности на большой высоте. BJOG. 2004; 111: 1051–8.

    PubMed Статья Google ученый

  • 36.

    Либерман Э, Греми И., Ланг Дж. М., Коэн А. П..Низкая масса тела при рождении в срок и время воздействия курения матери на плод. Am J Public Health. 1994. 84 (7): 1127–31.

    PubMed Статья CAS Google ученый

  • 37.

    Шу ХО, Хэтч М.С., Миллс Дж. И др. Курение матери, употребление алкоголя, потребление кофеина и рост плода: результаты проспективного исследования. Эпидемиология. 1995; 6: 115–20.

    PubMed Статья CAS Google ученый

  • 38.

    MacArthur C, Knox EG. Курение во время беременности: последствия отказа от курения на разных этапах. Br J Obstet Gynaecol. 1988; 95: 551–5.

    PubMed Статья CAS Google ученый

  • 39.

    Naeye RL, Blanc W, Leblanc W, Khatamee MA. Осложнения материнской героиновой зависимости для плода: аномальный рост, инфекции и эпизоды стресса. J Pediatr. 1973; 83: 1055–61.

    PubMed Статья CAS Google ученый

  • 40.

    Фулрот Р., Филлипс Б., Дюран диджей. Перинатальный исход младенцев, подвергшихся воздействию кокаина и / или героина в утробе матери. Am J Dis Child. 1989; 143: 905–10.

    PubMed CAS Google ученый

  • 41.

    Дивон М.Ю., Фербер А. Обзор причин и факторов риска для ограничения роста плода В: Локвуд С.Дж., Барсс В.А. (ред.) UpToDate http://www.uptodate.com, просмотрено 25.12.2012.

  • 42.

    Zhu BP, Rolfs RT, Nangle BE, Horan JM.Влияние интервала между беременностями на перинатальные исходы. N Engl J Med. 1994. 340 (8): 589–94.

    Артикул Google ученый

  • 43.

    • Д’Анджело Д.В., Уайтхед Н., Хелмс К. и др. Исходы родов при предполагаемой беременности у женщин, которые использовали вспомогательные репродуктивные технологии, стимуляцию овуляции или не получали лечения. Fertil Steril. 2011; 96 (2): 314–320.e2. В этом исследовании на основе исследуется влияние методов ВРТ на исходы родов .

    PubMed Статья Google ученый

  • 44.

    Вальфиш А., Халлак М. Гипертония. В: Джеймс Д.К., Стир П.Дж., Вайнер С.П., Гоник Б., редакторы. Варианты ведения беременности с высоким риском. Филадельфия: Эльзевир; 2006. с. 772–97.

    Google ученый

  • 45.

    Анг С., Хоу Д., Ламсден М. Диабет. В: Джеймс Д.К., Стир П.Дж., Вайнер С.П., Гоник Б., редакторы. Варианты ведения беременности с высоким риском.Филадельфия: Эльзевир; 2006. с. 986–1004.

    Google ученый

  • 46.

    Klatsky PC, Tran ND, Caughey AB, Fujimoto VY. Миома и репродуктивные исходы: систематический обзор литературы от зачатия до родов. Am J Obstet Gynecol. 2008. 198: 357–66.

    PubMed Статья Google ученый

  • 47.

    Куни MJ, Benson CB, Doubilet PM. Исход беременностей у женщин с аномалиями удвоения матки.Дж. Клин Ультразвук. 1998. 26 (1): 3–6.

    PubMed Статья CAS Google ученый

  • 48.

    Khader YS, Ta’ani Q. Заболевания пародонта и риск преждевременных родов и низкой массы тела при рождении: метаанализ. J Periodontol. 2005. 76 (2): 161–5.

    PubMed Статья Google ученый

  • 49.

    Клебанов М.А., Мейрик О., Берендес Х.В. Последствия недоношенного рождения для второго поколения.Педиатрия. 1989. 84 (2): 343–7.

    PubMed CAS Google ученый

  • 50.

    Лин СС, Сантолая-Форгас Дж. Современные концепции ограничения роста плода: часть I. Причины, классификация и патофизиология. Obstet Gynecol. 1998. 92 (6): 1044–55.

    PubMed Статья CAS Google ученый

  • 51.

    Хури М.Дж., Эриксон Д.Д., Кордеро Дж.Ф., Маккарти Б.Дж. Врожденные пороки развития и задержка внутриутробного развития: популяционное исследование.Педиатрия. 1988. 82 (1): 83–90.

    PubMed CAS Google ученый

  • 52.

    Wendel GD. Цитомегаловирус, генитальный герпес, краснуха, сифилис и токсоплазмоз. В: Queenan JT, Hobbins JC, Spong CY, редакторы. Протоколы беременностей с высоким риском: научно-обоснованный подход. 5-е изд. Оксфорд: Уайли-Блэквелл; 2010. DOI: 10.1002 / 9781444323870.ch45.

    Google ученый

  • 53.

    Adanu RMK. Малярия при беременности. В: Queenan JT, Hobbins JC, Spong CY, редакторы. Протоколы беременностей с высоким риском: научно-обоснованный подход. 5-е изд. Оксфорд: Уайли-Блэквелл; 2010. DOI: 10.1002 / 9781444323870.ch47.

    Google ученый

  • 54.

    Дивон М.Ю., Вайнер З. Ультразвук при беременности двойней. Семин Перинатол. 1995; 19: 404–12.

    PubMed Статья CAS Google ученый

  • 55.

    D’Alton ME, Simpson LL. Синдромы у близнецов. Семин Перинатол. 1995; 19: 375–86.

    PubMed Статья Google ученый

  • 56.

    • Миллер Дж., Чаухан С.П., Абухамад, Аризона. Дискордантные близнецы: диагностика, оценка и лечение. Am J Obstet Gynecol. 2012. 206 (1): 10–20. Этот экспертный обзор поможет нам понять ключевые аспекты лечения дискордантных близнецов на основе данных .

    PubMed Статья Google ученый

  • 57.

    Guenwald P. Рост человеческого плода II. Аномальный рост у близнецов и младенцев от матерей с диабетом, гипертонией или изоиммунизацией. Am J Obstet Gynecol. 1966; 94: 1120–32.

    Google ученый

  • 58.

    Каппеллетти М., Джаннелли С., Мартинелли А. и др. Отсутствие активации дендритных клеток периферической крови при беременности человека, осложненной задержкой внутриутробного развития. Плацента. 2013. 34 (1): 35–41.

    PubMed CAS Google ученый

  • 59.

    Лаурини Р., Лаурин Дж., Марсал К. Гистология плаценты и кровоток плода при задержке внутриутробного развития. Acta Obstet Gynecol Scand. 1994; 73: 529e34.

    Артикул Google ученый

  • 60.

    Wilkins-Haug L, Roberts DJ, Morton CC. Ограниченный плацентарный мозаицизм и задержка внутриутробного развития: анализ плаценты во время родов методом случай-контроль. Am J Obstet Gynecol. 1995; 172: 44e50.

    Артикул Google ученый

  • 61.

    Sato Y, Benirschke, Marutsuka K, et al. Связь ограничения внутриутробного развития с патологическими факторами плаценты, материнскими факторами и факторами плода; клинико-патологические данные 257 случаев заболевания в Японии. Histol Histopathol. 2013. 28 (1): 127–32.

    PubMed CAS Google ученый

  • 62.

    марта М.И., Чаухан С.П., Абухамад А. Ультразвук. В: Бергелла V, редактор. Акушерские рекомендации, основанные на фактических данных. 2-е изд. Великобритания: Informa Healthcare; 2012 г.п. 41–6.

    Глава Google ученый

  • 63.

    Робертсон Л., Ву О., Лангхорн П. и др. Тромбоз: риск и экономическая оценка исследования скрининга на тромбофилию (TREATS). Тромбофилия при беременности: системный обзор. Br J Haematol. 2006. 132 (2): 171–96.

    PubMed Статья CAS Google ученый

  • 64.

    Дугофф Л., Хоббинс Дж. С., Мэлоун Ф. Д. и др. Концентрация PAPP-A и свободной бета-субъединицы человеческого хорионического гонадотропина в материнской сыворотке в первом триместре и затылочная прозрачность связаны с акушерскими осложнениями: популяционное скрининговое исследование.Am J Obstet Gynecol. 2004; 191: 1446–51.

    PubMed Статья CAS Google ученый

  • 65.

    Дугофф Л., Хоббинс Дж. С., Мэлоун Ф. Д. и др. Консорциум FASTER Trial Research. Obstet Gynecol. 2005. 106 (2): 260–7.

    PubMed Статья Google ученый

  • 66.

    Dugoff L. Сывороточные маркеры материнской анеуплоидии и неблагоприятных исходов беременности в первом и втором триместре беременности.Obstet Gynecol. 2010. 115 (5): 1052–61.

    PubMed Статья Google ученый

  • 67.

    Мартин А.М., Биндра Р., Курсио П. и др. Скрининг преэклампсии и задержки роста плода с помощью допплерографии маточной артерии на 11–14 неделе беременности. Ультразвуковой акушерский гинекол. 2001. 18 (6): 583–6.

    PubMed Статья CAS Google ученый

  • 68.

    • Bujold E, Roberge S, Lacasse Y, et al.Профилактика преэклампсии и ограничения внутриутробного развития с помощью аспирина началась на ранних сроках беременности: метаанализ. Obstet Gynecol. 2010. 116 (2 Pt 1): 402–14. Понимание доказательств использования детской АСК до 16 недель беременности у женщин с риском ЗВУР .

    PubMed Статья Google ученый

  • 69.

    Морс К., Уильямс А., Гардози Дж. Скрининг роста плода путем измерения высоты дна. Лучшая практика Res Clin Obstet Gynaecol.2009; 23: 809–18.

    PubMed Статья Google ученый

  • 70.

    Gardosi J, Francis A. Контролируемое испытание измерения высоты дна матки, нанесенное на индивидуальные диаграммы дородового роста. Br J Obstet Gynaecol. 1999; 106: 309–17.

    PubMed Статья CAS Google ученый

  • 71.

    Чанг Т.К., Робсон СК, Бойз Р.Дж., Спенсер Дж. А.. Прогнозирование малого для гестационного возраста ребенка: какое ультразвуковое измерение лучше? Obstet Gynecol.1992. 80 (6): 1030–8.

    PubMed CAS Google ученый

  • 72.

    Сковрон М.Л., Берковиц Г.С., Лапински Р.Х. и др. Оценка ультразвукового скрининга в начале третьего триместра на задержку внутриутробного развития. J Ultrasound Med. 1991; 10: 153–9.

    PubMed CAS Google ученый

  • 73.

    Американский институт ультразвука в медицине. Практическое руководство AIUM по проведению акушерских ультразвуковых исследований.J Ultrasound Med. 2010. 29 (1): 157–66.

    Google ученый

  • 74.

    • Бурд И., Сринивас С., Паре Э. и др. Влияет ли выбор смеси на сонографическую оценку веса плода? J Ultrasound Med. 2009. 28 (8): 1019–24.

    PubMed Google ученый

  • 75.

    Benson CB, Doubilet PM. Сонографическое прогнозирование гестационного возраста: точность измерений плода во втором и третьем триместре.Am J Roentgenol. 1991. 157 (6): 1275–7.

    Артикул CAS Google ученый

  • 76.

    Саррис И., Иоанну С., Чемберлен П. и др. для Международного консорциума по развитию плода и новорожденного в 21 веке (INTERGROWTH-21st). Вариабельность результатов УЗИ плода у разных наблюдателей и у разных наблюдателей. Ультразвуковой акушерский гинекол. 2012; 39: 266–73.

    PubMed Статья CAS Google ученый

  • 77.

    Залуд И., Гуд С., Карнейро Г. и др. Биометрия плода: сравнение между опытными сонографистами и автоматизированными измерениями. J Matern Fetal Neonatal Med. 2009. 22 (1): 43–50.

    PubMed Статья Google ученый

  • 78.

    Кран JP, Копта MM. Прогнозирование задержки внутриутробного развития плода с помощью ультразвукового измерения отношения окружности головы к брюшной полости. Obstet Gynecol. 1979; 54: 597–601.

    PubMed CAS Google ученый

  • 79.

    Hadlock FP, Deter RL, Harrist RB и др. Независимый от даты предиктор задержки внутриутробного развития: отношение длины бедра к окружности живота. AJR Am J Roentgenol. 1983; 141: 979–84.

    PubMed Статья CAS Google ученый

  • 80.

    Винцилеос А.М., Лодейро Дж. Г., Файнштейн С. Дж. И др. Значение материального индекса плода в прогнозировании задержки роста. Obstet Gynecol. 1986; 67: 584–8.

    PubMed CAS Google ученый

  • 81.

    Рис Э.А., Гольдштейн I, Пилу Г, Хоббинс Дж. Рост мозжечка плода, не подверженный задержке внутриутробного развития: новый параметр для пренатальной диагностики. Am J Obstet Gynecol. 1987. 157: 632–8.

    PubMed CAS Google ученый

  • 82.

    Dilmen G, Toppare MF, Turhan NO, et al. Поперечный диаметр мозжечка и поперечный диаметр мозжечка / индекс окружности живота для оценки роста плода. Fetal Diagn Ther. 1996. 11 (1): 50–6.

    PubMed Статья CAS Google ученый

  • 83.

    Фигерас Ф, Гардози Дж. Следует ли настраивать стандарты роста плода. Fetal Diagn Ther. 2009. 25: 297–303.

    PubMed Статья CAS Google ученый

  • 84.

    Gardosi J, et al ..: Программа оптимального веса, связанная с беременностью (РОСТ). 2003. https://www.gestation.net/fetal_growth/download_grow.htm, дата обращения 25.12.2012.

  • 85.

    Gardosi J, Francis A. Индивидуальный стандарт для оценки роста плода в популяции США. Am J Obstet Gynecol. 2009; 201 (1): 25.e1–7.

    Артикул Google ученый

  • 86.

    Fleischer AC, Goldstein RB, Bruner JP, Worrell JA. Допплерография в акушерстве и гинекологии. В: Каллен П.У., редактор. Ультрасонография в акушерстве и гинекологии. 3-е изд. Филадельфия: У. Б. Сондерс; 1994. стр. 503–23.

    Google ученый

  • 87.

    Ferrazzi E, Bozzo M, Rigano S и др. Временная последовательность аномальных допплеровских изменений в периферической и центральной системах кровообращения у плода с серьезной задержкой роста. Ультразвуковой акушерский гинекол. 2002; 19: 140–6.

    PubMed Статья CAS Google ученый

  • 88.

    Башат А.А., Гембрух У., Харман ЧР. Последовательность изменений допплеровских и биофизических параметров по мере ухудшения серьезной задержки роста плода. Ультразвуковой акушерский гинекол.2001; 18: 571–7.

    PubMed Статья CAS Google ученый

  • 89.

    Башат А.А., Гембрух У., Вайнер С.П., Харман ЧР. Качественный анализ формы волны венозного допплера улучшает прогнозирование критических перинатальных исходов у преждевременных плодов с задержкой роста. Ультразвуковой акушерский гинекол. 2003. 22 (3): 240–5.

    PubMed Статья CAS Google ученый

  • 90.

    Башат А.А., Гюклю С., Куш М.Л. и др.Венозная допплерография в прогнозе кислотно-щелочного статуса плодов с ограниченным ростом и повышенной кривой плацентарного кровотока. Am J Obstet Gynecol. 2004. 191 (1): 277–84.

    PubMed Статья Google ученый

  • Вы и ваши гормоны от Общества эндокринологов

    Что такое прогестерон?

    Прогестерон принадлежит к группе стероидных гормонов, называемых «прогестагенами» (которые являются гормонами, которые имеют действие, аналогичное природному гормону прогестерону).Синтетические гормоны, которые действуют аналогично прогестерону, называются «прогестинами». Прогестерон в основном секретируется желтым телом яичников во второй половине менструального цикла. Он играет важную роль в менструальном цикле и в поддержании беременности на ранних сроках.

    Во время менструального цикла, когда яйцеклетка выходит из яичника во время овуляции (примерно на 14-й день), остатки фолликула яичника, окружающего развивающееся яйцо, образуют структуру, называемую желтым телом, что буквально переводится как «желтое тело». ‘из-за его внешнего вида.Это высвобождает прогестерон и, в меньшей степени, эстрадиол. Прогестерон подготавливает организм к беременности в случае оплодотворения выпущенной яйцеклетки. Если яйцеклетка не оплодотворяется, желтое тело разрушается, производство прогестерона падает, и начинается новый менструальный цикл.

    Если яйцеклетка оплодотворена, прогестерон стимулирует рост кровеносных сосудов, которые снабжают слизистую оболочку матки (эндометрий), и стимулирует железы в эндометрии выделять питательные вещества, которые питают ранний эмбрион.Затем прогестерон подготавливает тканевую выстилку матки для имплантации оплодотворенной яйцеклетки и помогает поддерживать эндометрий на протяжении всей беременности. На ранних стадиях беременности прогестерон все еще вырабатывается желтым телом и необходим для поддержания беременности и формирования плаценты. Как только плацента сформировалась, она берет на себя выработку прогестерона примерно на 8-12 неделе беременности «лютео-плацентарный сдвиг». Во время беременности прогестерон играет важную роль в развитии плода (он стимулирует рост ткани материнской груди, предотвращает лактацию и укрепляет мышцы тазовой стенки при подготовке к родам).Уровень прогестерона в организме неуклонно повышается на протяжении всей беременности, пока не начнутся роды и не появится ребенок.

    Хотя желтое тело в яичниках является основным местом выработки прогестерона у людей, прогестерон также в меньших количествах вырабатывается самими яичниками, надпочечниками и, во время беременности, плацентой.

    Как контролируется прогестерон?

    Формирование желтого тела (которое производит большую часть прогестерона) вызвано резким увеличением выработки лютеинизирующего гормона передней долей гипофиза.Обычно это происходит примерно на 14 день менструального цикла и стимулирует выход яйцеклетки из яичника (овуляцию) и образование желтого тела из остатка фолликула. Затем желтое тело выделяет прогестерон, который подготавливает организм к беременности. Если яйцеклетка не оплодотворена и эмбрион не зачат, желтое тело разрушается и выработка прогестерона снижается. Поскольку слизистая оболочка матки больше не поддерживается прогестероном из желтого тела, он отрывается и возникает менструальное кровотечение, знаменующее начало нового менструального цикла.

    Однако, если овулировавшая яйцеклетка оплодотворяется и дает начало эмбриону, клетки, окружающие этот ранний эмбрион (которым суждено сформировать плаценту), будут секретировать хорионический гонадотропин человека. ‘Data-content =’ 1392 ‘> хорионический гонадотропин человека. Этот гормон имеет очень похожую химическую структуру с лютеинизирующим гормоном. Это означает, что он может связываться с теми же рецепторами, что и лютеинизирующий гормон, и активировать их, а это означает, что желтое тело не разрушается и вместо этого продолжает вырабатывать прогестерон до тех пор, пока не установится плацента.

    Что произойдет, если у меня будет слишком много прогестерона?

    Нет никаких известных серьезных медицинских последствий из-за того, что организм вырабатывает слишком много прогестерона. Как упоминалось выше, уровень прогестерона повышается естественным образом во время беременности. Высокий уровень прогестерона связан с состоянием «врожденная гиперплазия надпочечников» data-content = ‘1315’> врожденная гиперплазия надпочечников. Однако высокий уровень прогестерона является следствием, а не причиной этого состояния.
    Прием прогестерона в высоких дозах в виде лекарств может быть связан с небольшим повышенным риском развития рака груди.

    Прогестерон, отдельно или в комбинации с эстрогеном, женщины принимают в качестве орального контрацептива («таблетки»). «Таблетка» предотвращает овуляцию, а также сгущает цервикальную слизь, что делает ее эффективной в предотвращении беременности.

    Прогестерон используется в заместительной гормональной терапии для облегчения симптомов менопаузы у женщин. Есть много признанных плюсов и минусов заместительной гормональной терапии — см. Статью о менопаузе для получения дополнительной информации.

    Что произойдет, если у меня слишком мало прогестерона?

    Если прогестерон отсутствует или его уровень слишком низкий, могут возникнуть нерегулярные и обильные менструальные кровотечения.Снижение уровня прогестерона во время беременности может привести к выкидышу и преждевременным родам. Матерям с риском слишком ранних родов можно дать синтетическую форму прогестерона, чтобы отсрочить начало родов.

    Недостаток прогестерона в кровотоке может означать, что яичник не может освободить яйцеклетку во время овуляции, что может происходить у женщин с синдромом поликистозных яичников.


    Последний раз отзыв: июль 2021 г.


    .

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *