Рубрика

Диету: Популярные диеты для быстрого похудения

Содержание

Популярные диеты для быстрого похудения

Тощая диета
Предположительная эффективность: минус 4 кг за неделю.

Диета рассчитана на семь дней, каждый из которых очень строго расписан. Первый — литр молока. Второй — 500 г творога и 800 мл сока без сахара (кроме виноградного и бананового). Третий — фрукты и литр минеральной воды без газа. Четвертый — десяток сваренных в мундире картофелин и снова сок. Пятый — полтора килограмма яблок. Шестой — полкило постной говядины и сок. Седьмой — только два литра кефира.
Мнение диетолога: Диета с резким ограничением калорийности. Средняя калорийность дня – 750 – 800 ккал. Для выполнения этой диеты нужна сильная мотивация. Может наблюдаться головокружение, различные вегетативные расстройства. Для снижения риска развития побочных эффектов рекомендуется дополнительный прием поливитаминных комплексов. Желательно проводить диету под контролем врача.


ХОЧУ ПОХУДЕТЬ ЗА 30 дней
Кефирно-гречневая диета
Предположительная эффективность: минус 7–12 кг за одну-две недели.

Гречку в данном случае не варят, а только заваривают: заливают кипятком из расчета полтора стакана воды на стакан крупы, хорошенько укутывают и оставляют на ночь. В течение дня ее можно есть, сколько угодно — не приправляя специями, солью и соусами. И плюс к тому выпивать литр 1% кефира. Между приемами пищи разрешается добавить пару несладких фруктов, салат из капусты, зелень, ложку меда — чтобы не сорваться. И в неограниченном количестве пить воду, зеленый или травяной чай (не менее 1 л в сутки).
Мнение диетолога: Диета с ограничением жиров, с умеренным снижением калорийности. Придерживаясь данной диеты, можно сохранить регулярные тренировки, однако снизить их по интенсивности относительно привычных на 30%. Долго такую диету выдержать трудно. Также развивается дефицит жирорастворимых витаминов, застой в желчном пузыре, остеопороз, другие нарушения обмена веществ.
Десятидневная белковая диета
Предположительная эффективность: минус 10 кг, плюс более крепкие мышцы.

Уже само название диеты подсказывает, что она разрешает белки, причем в любом количестве. В том числе жирное мясо, колбасу, сало, яйца. И запрещает углеводы, причем не только мучное и сладкое, но и любой хлеб, абсолютно все крупы, фрукты и даже некоторые овощи: морковь, картофель, кукурузу, свеклу. Нельзя ни кефира с йогуртами, ни креветок с кальмарами, ни печени, ни орехов… Из того немногого, что осталось, можете сами спланировать рацион на каждый день: сочетание продуктов и величина порций остаются исключительно на ваше усмотрение.
Мнение диетолога: Диета с ограничением углеводов. Больше подходит для людей, моложе 30 лет. Может наблюдаться быстрая потеря массы, особенно на первой неделе. Однако придерживаться данной диеты долгое время очень сложно, сохраняя активный образ жизни и трудовую деятельность. Высокий риск появления головных болей, раздражительности, тревожности, депрессивных состояний, нарушения настроения, сна, подъема артериального давления, появления запоров или расстройства стула.

Американские горки Мартина Катана
Предположительная эффективность: при 40 минутах фитнеса в день — 8–9 кг в неделю.

Рассчитана на три недели, для каждой из которых прописаны только калории. Исходя из чего вы сами решаете, что будете есть в каждый конкретный день. Первые три дня первой недели нужно уложиться в 600 ккал в сутки, следующие четыре — в 900 ккал. Всю вторую неделю ежедневно потребляем 1200 ккал. И на третьей возвращаемся к схеме первой.
Мнение диетолога: Вариант диеты с низкой калорийностью, соответственно минусы те же. Эффективность данного способа выше, т.к. изменения в питании сочетаются с выполнением ежедневной физической нагрузкой.

Молочно-салатная диета
Предположительная эффективность: минус 5 кг за неделю.

Все предельно просто: вы чередуете «молочный» день и «салатный». В «молочный» можно съесть 500 г обезжиренного творога и выпить 1 л кефира. А в салатный — потреблять фрукты и овощи в любом количестве и, как вариант, в виде салатов, которые допускается заправлять оливковым или растительным маслом (условно-салатный день).
Мнение диетолога: Это чередование двух классических разгрузочных дней в течение недели. Однако разгрузочный день рациональнее проводить не чаще одного или двух раз в неделю. Наиболее часто используются углеводные или белковые дни. Проведение разгрузочных дней подряд в течение длительного времени приведет к потере мышечной массы, а как следствие этого к плохому самочувствию, слабости. Если данный способ снижения веса Вам наиболее подходит, то обязательно принимайте параллельно поливитамины, двигательную активность необходимо снизить.

Японская диета
Предположительная эффективность: до 8 кг за 13 дней.

Меню этой диеты очень подробно расписано на все 13 дней. На завтрак почти всегда — чашка кофе с сухариком или без. Обеды и ужины довольно разнообразны и предполагают порции мяса, вареной или жареной рыбы, приправленные маслом сырые и отварные овощи, кефир, яйца, томатный сок. Между приемами пищи можно пить в неограниченном количестве воду. Строго запрещены сахар и алкоголь, мучные и кондитерские изделия. Все блюда готовят и едят без соли, иначе, как говорят авторы диеты, она просто не подействует. Результат «японки» сохраняется два-три года.
Мнение диетолога: если соблюдать эту диету долго, можно достичь солидных результатов. Но проблема в том, что удержать достигнутый результат очень трудно. Может наблюдаться постоянный голод, сухость кожи, выпадение волос, нарушение со стороны пищеварительного тракта.

Ловушки и минусы экспресс-диет
  • Вес уходит в основном за счет воды и после завершения диеты быстро возвращается.
  • Серьезно теряют в весе лишь очень полные люди, но не те, кто весит 65–70 кг.
  • Именно после экспресс-диет, в том числе и белковых, больше всего обвисает кожа.
  • От них страдают желудочно-кишечный тракт, печень и почки.
  • Из-за них замедляется обмен веществ, похудеть в дальнейшем становится труднее.
Мнение профессионала Анна Никитова, врач-терапевт, диетолог, врач ЛФК и спортивной медицины, руководитель подразделения «Восстановительный фитнес» клуба ФизКульт Спорт:
Итак, несмотря на многообразие диет, остановить свой выбор на какой–либо одной очень сложно, т. к. каждая из них имеет много ограничений в наборе продуктов и режиме питания. Также все они обладают довольно ощутимыми минусами: главный их недостаток – они рассчитаны на кратковременное применение, а значит и на недолгий результат. Удержание достигнутого веса не происходит.
Я считаю - и это подтверждает мой личный опыт -, что достигнуть надежного долгосрочного результата с помощью хитроумных диет НЕВОЗМОЖНО.
Для того чтобы похудеть, необходимо полностью изменить свой образ жизни. Похудение – это целый комплекс взаимосвязанных мер и правил, которым нужно следовать каждый день.
Моя программа работы с лишним весом – это комплексный подход, который позволяет человеку безопасно для своего здоровья и комфортно изменить свой привычный стереотип питания и двигательной активности.

🧬 Стоит ли выбирать диету?

В двухтысячные годы Россию захватила кремлевская диета. Люди массово считали баллы, а некоторые даже отправляли свои результаты в газету. С появлением интернета диет стало намного больше: питьевая, Дюкана и т.д.. Рассказываем, что с ними не так, почему они не дают желаемого эффекта и как сбрасывать вес правильно.

Что это такое

Больше ста лет назад советский диетолог Михаил Певзнер разработал 15 диетических столов на все случаи: первый — для недавно прооперированных пациентов, девятый — для диабетиков, пятнадцатый — для всех подряд. Страдающим гастритом предлагали отказаться от свежего хлеба, молочных продуктов и богатых клетчаткой овощей. Считалось, что такое питание защищает от обострений и прогрессирования болезни. Но в начале двухтысячных австралийские ученые доказали, что причина гастрита — бактерия Helicobacter pylori, и работать нужно с ней, а не с количеством огурцов в рационе. За это группе исследователей дали Нобелевскую премию.

Остальные столы по Певзнеру официально вывели из рекомендаций в 2003 году. Их признали неэффективными: стол подходил усредненной модели заболевания. Она не учитывала особенности клинических проявлений у каждого пациента и сопутствующих патологий. Вместо столов предложили диеты по энергетическому составу и щадящий рацион.

Как работает

Контролировать вес с помощью рациона научились задолго до соцсетей. До революции женского костюма, начавшейся с легкой руки Коко Шанель, дамы носили корсеты, в котором трудно перебрать за обеденным столом. Дальше — знаменитый совет Майи Плисецкой, объясняющий утонченность формы примы-балерины, затем — эра шейпинга, фитнеса и глянцевых журналов с сотнями диет. Они строились по разному принципу: одни демонизировали определенные продукты, другие требовали подсчета баллов, калорий или «БЖУ», третьи предлагали готовый рацион без особой логики подбора составляющих.

Например, белковая диета Дюкана, популярная в начале 2010-х. Известный французский врач решил, что виновник лишнего веса — углеводы, и предложил снизить их количество в рационе до минимально необходимого. В России издали две книги о диете Дюкана — одна объясняла ее принцип, другая предлагала рецепты. Девушки создавали группы в соцсетях, делились рецептами протеиновых тортов и запеканок, худели и радовались результатам, но недолго. Во Франции провели опрос и доказали: 80% приверженцев диеты Дюкана набирают лишние килограммы обратно за четыре года.

Во время культа анорексии были популярны экстремальные диеты. Например, питьевая, когда можно есть только жидкую пищу и напитки. Или шоколадная, при которой весь дневной рацион — стограммовая плитка шоколада. Есть и более жесткий вариант — диета ABC, обещающая привести к 30-килограммовому идеалу за 50 дней питания на 50-200 ккал или голода.

Сейчас в моде ЗОЖ, а добиваться красивой фигуры предлагают «здоровыми» способами. Например, с помощью правильного питания или ПП — схемы рациона, при которой продукты и блюда делятся на «хорошие» и «плохие». Или, например, кето-диеты, когда человек ест много жирной пищи и мало углеводистой. Если человек все же срывается на конфеты и торты, фитнес-блогеры и медиа предлагают интервальное голодание — есть что и сколько угодно, но в течение определенного количества часов. Интервальных схем почасовых разбивок несколько, но они дают кратковременный эффект и при постоянном применении нарушают метаболизм.

Почему диета не работает в перспективе

В соцсетях много положительных отзывов на диеты, но мало кто вдается в детали. Англоязычный инстаграм богат фотографиями «до и после , где 150-килограммовые женщины превращаются в миниатюрных дам. Авторы таких публикации пишут, что секрет похудения — кето-диета или любой другой особый рацион, который по счастливой случайности можно у них купить. Но умалчивают, что, например, перед началом кето-диеты сделали бандажирование желудка — операцию, которую в некоторых развитых странах делают бесплатно по страховке.

«Польза кето-диеты долго обсуждалась в Гарвардской медицинской школе, и пока мнение едино: рекомендовать ее можно только для детей с определенными формами эпилепсии. Было доказано, что при низком потреблении углеводов и высокого — жиров, реже случаются приступы. Во всех остальных случаях эта диета вредна, — говорит диетолог GMS Clinic Светлана Артемова, — Резкий отказ от углеводов чреват серьезными нарушениями. Человеку в сутки нужно минимум 120 грамм. Лучше — в виде зерновых».

Диета с резким ограничением белков жиров или углеводов неизбежно ведет к срыву. Если не прекратить нездоровые попытки похудеть, можно заработать расстройство пищевого поведения и ожирение — это доказало пятилетнее наблюдение за девушками и юношами. Девочки-подростки все еще объединяются в группы, создают чаты и поддерживают друг друга на пути к болезненной стройности.

«Ни одна диета в долгосрочной перспективе не показала свою эффективность. Это провокатор расстройств пищевого поведения — рассказывает детский психиатр клиники „Фэнтези“ Марина Гармаш. — Практически во всех случаях через 3 года вес возвращался к прежним цифрам, либо даже увеличивался. Все рационы с жестким ограничением калорий, как и моно-диеты существенно ограничивают привычный рацион по калорийности, разнообразию и питательности. Опасность в том, что человек не запрограммирован на моно-питание: ежедневно ему нужны разные группы продуктов. Такие диеты могут снизить вес, но за счет урезания углеводов. Это ведет к потере жидкости и минусу на весах. Но как только человек вернется к своему прежнему питанию, вес моментально возвращается, а вот диетический опыт спровоцирует переедание, ухудшит контакт со своим телом и умение распознавать чувство голода и насыщения. Увлечение диетами может „обострить“ хронические заболевания. Например, со стороны ЖКТ или мочеполовой системы».

Это и случилось с Анной из Новосибирска. После колкого замечания от одноклассника она села на диету. Пройдя несколько циклов «срыв-диета», она сбросила несколько килограммов, но на этом не остановилась. Даже когда близкие забили тревогу, Анна продолжала худеть, пока не дошла до критически низкого веса. Результат — большие проблемы со здоровьем и бесплодие.

Деление еды на «хорошую» и «плохую» ненаучно: организму без разницы, откуда он получает энергию. Демонизация сахара тоже базируется на личном мнении некоторых диетологов и фитнес-тренеров. В Австралии провели исследование и выяснили, что употребление сахара в последнее время снизилось, но число людей с ожирением при этом стабильно растет. Это явление назвали австралийским парадоксом. Ученые выяснили: главный виновник ожирения не сахар, а переедание.

«Современные научные данные не признают существование пищевой зависимости человеческого организма от каких-либо конкретных пищевых нутриентов и продуктов питания. Можно говорить о зависимости от еды вообще и от самого процесса ее употребления. У человека бывает субъективное привыкание к еде, как часть сложного процесса активации системы вознаграждения, — поясняет Марина Гармаш, — Демонизация сахара и его ограничения в итоге ведут к его избыточному потреблению с последующим чувством вины, что в свою очередь служит риском начала расстройства пищевого поведения».

Когда диета нужна

При определенных заболеваниях. Например, для гипертоников доказана польза DASH-диеты. Это — рацион, богатый свежими овощами, злаками и фруктами, при этом в нем мало животных жиров и соли. Такой стиль питания снижает давление и уменьшает риск сердечно-сосудистых катастроф на 13%. А если добавить физическую нагрузку, можно еще и похудеть.

Диету соблюдают люди с нарушениями усвоения различных веществ. Например, целиакией — непереносимостью глютена. Они избегают продукты, богатые клейковиной — пшеницу, рожь, колбасы, консервы, некоторые соусы и йогурты. Ограничивать себя приходится и тем, кто страдает галактоземией — непереносимостью лактозы молока. Оба состояния выявляют в лаборатории по анализу крови, назначаемому врачом.

Как худеть правильно

Причина лишнего веса — переедание. Чтобы похудеть, достаточно есть меньше, а двигаться больше. Все удачные случаи похудения базируются на этом принципе. Адекватного ограничения калорийности рациона хватит, чтобы похудеть. Узнать свою суточную норму поможет калькулятор.

«Если у человека нет ожирения, то достаточно дефицита калорий и сбалансированного питания. Важно не переусердствовать: резкое ограничение может привести к набору веса. В рационе обязательно должны присутствовать „быстрые“ углеводы, — говорит Светлана Артемова, — Например, перед тренировкой или когда надо быстро восполнить дефицит глюкозы. Если у человека ожирение, врач выясняет причину и назначает лечение. Он выбирает удобную модель питания, которой человек будет придерживаться всю жизнь, ведь ожирение — это хроническое неизлечимое заболевание».

Организму без разницы, откуда брать энергию — из гамбургера или курицы с гречкой. При этом сложные углеводы из злаков и качественные животные белки дают чувство сытости на несколько часов и энергию. Вот в чем ловушка: богатая жирами и углеводами еда «запутывает» систему насыщения головного мозга, заставляя есть больше тортов и мороженого. Запрещать их нельзя, нужно просто есть в меру.

Иногда дело не в лишнем весе, а в образе тела. Многие девушки нормального телосложения хотят похудеть, чтобы стать экстремально худыми или «досушиться» до рельефа и тонкой талии, как у популярных блогеров и моделей. При этом они забывают, что нереалистичные фигура медийной личности — скорее всего заслуга фотошопа, скальпеля в грамотной руке хирурга или врожденной стройности, добиться которой почти невозможно здоровым путем. Для фитнес-моделей тело — источник заработка, на поддержание которого уходят все ресурсы.

«Здоровых способов похудения ниже нормы нет, а диеты не работают. У девочки со сверхценными идеями похудения скорее всего разовьется расстройство пищевого поведения, — рассказывает Марина Гармаш, — Чтобы это не произошло, нужна психотерапевтическая работа, направленная на правильное самовосприятие».

Обычному человеку не нужно терпеть лишения и по семь раз в неделю заниматься в зале. Достаточно есть в пределах нормы калорийности и активно двигаться в течение дня.

Важно запомнить

  • Диеты не помогут похудеть надолго
  • Сахар и углеводы — не зло, а полезный инструмент, если предстоит серьезная нагрузка
  • Тяжелые ограничения ведут к расстройствам пищевого поведения и в итоге — к еще большему набору жировой массы.

Диета для ленивых - меню на неделю, основные правила

Диета для ленивых, конечно, не означает, что можно вовсе ничего не делать. Есть некоторые рекомендации, которых следует придерживаться. Но они не потребуют от вас нечеловеческой выдержки.

Содержание статьи

1. Ленивая диета для похудения – основные правила 2. Диета для ленивых  – меню на каждый день 2.1 1-й день 2.2 2-й день 2.3 3-й день 2.4 4-й день 2.5 5-й день 2.6 6-й день 2.7 7-й день 3. Диета для ленивых – минус 12 кг: отзывы 4. Диета для ленивых: предосторожности Скрыть

Лишний вес – проблема крайне распространенная. Миллионы людей по всему миру пробуют различные диеты, пытаясь похудеть – но не всегда есть время и ресурсы на то, чтобы полноценно контролировать свое питание. Какие-то диеты требуют много времени на готовку, какие-то подразумевают особое питание, плюс, конечно, к любой диете необходимо добавлять физическую активность... Все это отвращает людей от похудения, однако есть диеты, которые не налагают огромного количества ограничений, и одна из таких – диета для ленивых. Преимущество этой диеты состоит в том, что при своей достаточно небольшой продолжительности (рассчитана диета для ленивых на 2 недели максимум) она помогает выработать очень полезную привычку – пить достаточное количество воды.

РЕКЛАМА – ПРОДОЛЖЕНИЕ НИЖЕ

В наше время набор напитков огромен, и далеко не все они могут хотя бы как-то быть причислены к «здоровому» питью. Высокое содержание сахара, кофеина, всевозможных красителей не идет на пользу никому. Про чистую воду мы при этом часто забываем, и совершенно зря – достаточное ее потребление критически важно для организма. На этом и основана «диета для ленивых минут 12 кг» – вы приучаетесь пить чистую воду в нужном вам количестве, ну и заодно заполняете место в желудке не едой, а водой. В результате общая калорийность одного приема пищи может упасть на 75-90 калорий, согласно исследованиям, опубликованным в журнале «Obesity». И это происходит не только потому, что вы едите меньше, но и потому, что вода заменяет часть не самых полезных напитков.

РЕКЛАМА – ПРОДОЛЖЕНИЕ НИЖЕ

Итак, в чем же суть диеты для ленивых?

Ленивая диета для похудения – основные правила

РЕКЛАМА – ПРОДОЛЖЕНИЕ НИЖЕ

Главное правило диеты для ленивых – за 20-30 минут до приёма пищи выпивать стакан воды. Это помогает умерить аппетит и ускорить пищеварение. А вот во время еды от питья лучше воздержаться. Рекомендуется пить не раньше, чем через час после трапезы.

С водой мы разобрались. А что же с едой? На ленивой диете для похудения разделите дневной рацион минимум на 4 приёма. Есть следует часто, чтобы не допустить чувства голода, так как оно тормозит метаболизм.

Диета для ленивых в домашних условиях основана на принципах раздельного питания. Это значит, что вы едите отдельно белки и углеводы, например мясо без гарнира. Гарнир можете отложить до следующего приёма пищи. Все насыщенные углеводами крупы рекомендуется съедать в первой половине дня. Ужин составьте из белка и овощей.

РЕКЛАМА – ПРОДОЛЖЕНИЕ НИЖЕ

Диета для ленивых  – меню на каждый день

Меню диеты для ленивых включает нежирное мясо, много растительной клетчатки (овощи, фрукты), молочные продукты с низкой жирностью. Под запретом выпечка, копчёности, солёная пища, фастфуд.

Приводим примерное меню диеты для ленивых на неделю.

1-й день

Завтрак: нежирный творог, фрукты.

Обед: 100 г рыбы на пару, овощной салат.

Полдник: яблоко.

Ужин: два варёных яйца, 50 г куриной грудки.

2-й день

Завтрак: капуста, тушенная без масла.

Обед: куриный бульон, овощной салат.

Полдник: обезжиренный йогурт, фруктовый салат.

Ужин: 70 г отварной рыбы, овощной салат.

РЕКЛАМА – ПРОДОЛЖЕНИЕ НИЖЕ

3-й день

Завтрак: салат из помидоров, перца и баклажанов.

Обед: грибной бульон, черный хлеб.

Полдник: творог с ягодами.

Ужин: 100 г варёной говядины, овощи.

4-й день

Завтрак: салат из капусты с огурцами и зеленью.

Обед: овощной суп, бездрожжевой хлеб.

Полдник: персик.

Ужин: паровые рыбные котлеты, овощной салат.

РЕКЛАМА – ПРОДОЛЖЕНИЕ НИЖЕ

5-й день

Завтрак: творог с йогуртом и фруктами.

Обед: рыба на пару, ломтик ржаного хлеба.

Полдник: яблоко и груша.

Ужин: 100 г отварной говядины, овощи.

6-й день

Завтрак: варёное яйцо, черный хлеб с сыром.

Обед: 80 г куриной грудки, овощной салат.

Полдник: нектарин.

Ужин: 70 г говядины, овощной салат.

РЕКЛАМА – ПРОДОЛЖЕНИЕ НИЖЕ

7-й день

Завтрак: цветная капуста с куркумой.

Обед: бульон из индейки.

Полдник: сливы.

Ужин: варёное яйцо, салат, 50 г рыбы.

Диета для ленивых – минус 12 кг: отзывы

Отзывы худеющих подтверждают, что на диете для ленивых можно потерять до 10 – 12 кг за две недели.

Помните, что «ленивая» диета противопоказана при беременности, заболеваниях почек, дефиците кальция и авитаминозе, а также при грудном вскармливании, болезнях желудочно-кишечного тракта, сердца, печени. Если у вас есть хоть капля сомнений по поводу диеты – проконсультируйтесь с врачом, уточни, можно ли вам таким образом нагружать свой организм (а любая диета – это нагрузка). Возможен сокращенный вариант диеты – на 7 дней, разумеется, скинете вы при этом не 10-12 кг, но результаты все же будут.

РЕКЛАМА – ПРОДОЛЖЕНИЕ НИЖЕ

Многие выбирают диету для ленивых как способ быстро расстаться с лишними килограммами, и это вполне оправдано, но не у всех диета однозначно работает. Если организм обезвожен, возможен даже некоторый набор веса поначалу, да и без дополнительных пищевых ограничений одна вода не будет работать настолько эффективно, чтобы действительно ушло 10-12 кг. Пожалуй, никакой воде не победить фастфуд и ежедневные ночные визиты к холодильнику (но мы уверены: если вы решили худеть, то, конечно, это совсем не про вас), да и физические нагрузки необходимы, чтобы держать организм в тонусе. Тем не менее, как мы уже говорили, даже если просто пить стакан или два воды за 20-30 минут до еды, есть будет хотеться не так сильно, и отзывы по диете для ленивых это подтверждают. Да и метаболизм вода разгоняет достаточно успешно.

РЕКЛАМА – ПРОДОЛЖЕНИЕ НИЖЕ

Также те, кто практиковал такую диету, говорят, что стакан воды – это общая рекомендация, кто-то может без проблем для себя выпить два стакана или полтора, все зависит от конкретного человека. А вот что не зависит – это то, что вода для питья должна быть комнатной температуры, не слишком горячей и не слишком холодной, и пить ее нужно не залпом, а маленькими глотками. Это может быть вода из скважины, минеральная или просто отфильтрованная. Кстати: любые напитки при такой диете считаются перекусами, так что перед тем, как попить чаю или кофе, придется сперва выпить воды и подождать. В этом еще одно преимущество диеты – мелкие перекусы сходят на нет, так как обычно они результат сиюминутного желания что-нибудь пожевать, а получасовая подготовка в эту концепцию не укладывается. Получается, что гораздо проще питаться размеренно, соблюдая определенные временные интервалы, а это как раз очень полезно для организма.

РЕКЛАМА – ПРОДОЛЖЕНИЕ НИЖЕ

Те, кто следовал диете для ленивых, отмечают как плюс то, что она не требует особенных финансовых затрат, даже скорее можно сэкономить – потому что от фастфуда и полуфабрикатов лучше все-таки отказаться. Кроме того, достаточное количество фруктов и овощей, которое подразумевает диета для ленивых, означает, что ваш организм получает больше необходимых ему витаминов. Еще один бонус для здоровья! Ну и, конечно, удобно, что во многих случаях можно не готовить себе отдельно, а есть то же, что и все, только меньшими порциями.

РЕКЛАМА – ПРОДОЛЖЕНИЕ НИЖЕ

Диета для ленивых: предосторожности

Тем не менее, любая диета – это некоторые ограничения, и важно с этими ограничениями не переборщить. Прежде всего, при соблюдении диеты для ленивых ориентируйтесь на свой комфорт. Если вам придется постоянно пересиливать себя, вероятность срыва значительно повысится, и очень обидно будет, если недельные результаты перекроет фуд-спринт на выходных. Если вам некомфортно пить два стакана воды – пейте один. Теплая вода пьется лучше – пейте теплую. Кажется, что воды все равно не хватает – замените мясо или рыбу с гарниром на суп, супы в целом очень хорошо идут при такой диете.

Если вы много времени проводите на ногах, вне дома или офиса, планируйте свой дневной маршрут. Много воды на входе означает, что и на выходе ее тоже много.

РЕКЛАМА – ПРОДОЛЖЕНИЕ НИЖЕ

Следите за своим самочувствием и состоянием. Вполне вероятно, что в первое время потребуется дополнительно пить витамины, так как часть питательных веществ уйдет вместе с той пищей, от которой вы откажетесь, а для того, чтобы найти баланс, нужно время.

Диета для ленивых продолжается две недели, но это не значит, что сразу после нее можно будет есть что угодно и сколько угодно. Если вы хотите поддерживать вес и не давать ему расти – режим питания нужно будет все же соблюдать, иначе утраченные килограммы вернутся обратно, и может так случиться, что вы, наоборот, наберете дополнительный вес вместо того, чтобы оставаться в том, который вам нужен. Однако если за эти две недели вы «втянетесь» в процесс, то, скорее всего, научитесь распознавать сигналы своего организма и будете понимать, когда вы действительно голодны, а когда достаточно будет только попить воды.

РЕКЛАМА – ПРОДОЛЖЕНИЕ НИЖЕ

Постарайтесь не ограничиваться диетой: по возможности добавьте физических нагрузок. Так процесс похудения пойдет намного быстрее и эффективнее, кроме того, просто сбросить вес часто бывает недостаточно, гораздо красивее выглядит стройная фигура с рельефом – а именно этого и позволяет добиться спорт.

Планируйте меню при диете для ленивых заранее, баланс очень важен. Организм должен получать все питательные вещества и витамины, которые ему необходимы, иначе вы только навредите своему здоровью.

По отзывам, диета для ленивых достаточно эффективна при борьбе с лишним весом, если воспринимать ее не как кратковременные изменения в рационе, а как переходный период, помогающий выработать полезные привычки. Если вы до этого часто употребляли фастфуд, жирную или соленую пищу, полуфабрикаты – диета для ленивых поможет вам выправить режим приема пищи, и после нее вам будет намного проще перейти на правильное питание.

Самые эффективные диеты для похудения: диета в домашних условиях

Самая эффективная диета для быстрого похудения: подборка лучших систем и методик с описанием, правилами, достоинствами, возможными трудностями и противопоказаниями.

Самая эффективная диета для похудения в домашних условиях

Решив похудеть, женщины пересматривают свой рацион. Есть два варианта: сбалансировать питание и режим физических нагрузок, и привести вес в норму в режиме минус 0,5-2 кг в неделю, или же похудеть быстро на одной из экстремальных, но эффективных диет. Какой вариант вам нравится больше? Многие девушки выбирают быстрые способы похудения, ведь так хочется увидеть результаты уже через несколько дней!

Однако у быстрых эффективных диет есть обратная сторона: результат краткосрочный. Потерянные путем голодания килограммы возвращаются так же быстро, как и уходили. К тому же экстремальные способы похудения – практически одноразовые. Они помогают снизить вес раз, два. Но со временем перестают работать. Это связано с тем, что периоды острого дефицита калорий – стресс для организма, и постепенно он «учится» ему противостоять. Поэтому все больше девушек отдают предпочтение не экстремальным методам снижения веса, а здоровому сбалансированному питанию, которое гарантирует долгосрочный результат.

Но иногда все-таки нужно похудеть быстро: перед спортивными соревнованиями, особыми датами или событиями. В списке требований к некоторым профессиям указаны нормы веса, и если вы выбиваетесь из стандарта, решить проблему может только быстрая и эффективная диета. Мы собрали самые популярные режимы питания, помогающие избавиться от 5-10 избыточных килограммов. Но соблюдайте разумную осторожность! У резкого ограничения рациона могут быть побочные эффекты.


ТОП-5 самых эффективных диет

Наиболее простой и быстрый способ сбросить несколько килограммов в домашних условиях – это монодиеты. У них несколько недостатков: однообразие блюд, вызывающее дефицит витаминов и микроэлементов, стремительное возвращение потерянных килограммов, необходимость консультироваться с врачом. И все же они принадлежат к числу наиболее эффективных диет для экспресс-похудения.


Кима Протасова

Подходит тем, кто любит овощи и с легкостью обходится без мяса. Рацион, составленный Протасовым, рассчитан на 5 недель. Он построен на сырых овощах с небольшим добавлением кисломолочных продуктов. Меню выглядит примерно так:

  • завтрак: несладкий кофе, нежирный йогурт, яблоко;
  • второй завтрак: огурцы с домашним сыром;
  • обед: чай, яблоко, салат с тертым сыром;
  • полдник: морковь, листья салата, яблоко;
  • ужин: вареное яйцо, помидоры с зеленью и кефир.

Диета для ленивых

Иногда времени на кулинарию и сложные рецепты нет. Хорошая новость в том, что существуют эффективные диеты, не требующие кулинарных изысков. Главный принцип «ленивого» рациона: перед едой нужно выпивать 2 стакана чистой теплой воды. Обязательно только теплой! Суть простая: теплая вода будет гасить чувство голода, в то же время не давая переедать.

В рамках этого способа быстро снизить вес нужно есть трижды в сутки, ограничений по продуктам практически нет. Хотя от сладостей, жирных и жареных блюд, а также алкоголя и газированных напитков лучше все же отказаться.


Гречневая

При помощи этой монодиеты можно сбросить до 10 кг за неделю. Однако гречневую кашу нужно не варить, а запаривать. Из-за этого она становится не такой уж вкусной, зато помогает снизить вес. Сначала промойте крупу, залейте кипятков и дождитесь полного разбухания крупинок. Это занимает много времени, поэтому запаривать кашу нужно за 12 часов. Лучше всего делать это с  вечера. К гречке добавьте чуть-чуть соли, специй, ложку соевого соуса.

Полученное количество крупы разделите на 5 приемов пищи и съешьте в течение дня. Последний прием пищи должен состояться не позже, чем за 5 часов до сна. За полчаса до еды выпейте стакан воды. Также можно пить несладкий зеленый чай. Но злоупотреблять этой эффективной диетой не стоит, иначе рискуете «заработать» болезни желудочно-кишечного тракта.


Диета Дюкана

Это белковый рацион, который базируется практически на полном отказе от углеводов. Пьер Дюкан уверял, что так можно питаться постоянно, разнообразя меню. И все же рацион, созданный Дюканом, подходит не всем, а только тем, кому нужно сбросить от 10 кг, и кто готов ждать результатов месяц или дольше.

Переход на безуглеводный рацион происходит в несколько этапов. Сначала вы полностью отказываетесь от углеводов, заменяя их белком. Затем чередуете овощи и белок, стабилизируя вес. Затем можно по чуть-чуть вводить углеводы в рацион, но их доля все равно не должна превышать 10% от общего числа продуктов.

Самая простая диета

Монодиеты подходят не всем: их бывает сложно выдержать из-за однообразия рациона, резкого сокращения количества углеводов, необходимости поиска особых продуктов. Но есть способы снизить вес без соблюдения большого числа сложных кулинарных условий.


Кефирная диета

Один из самых популярных вариантов экстренного снижения веса – кефирная монодиета. Выдержать ее непросто, зато никаких сложностей с планированием рациона и графика приема пищи. Суть в том, что вы выпиваете в сутки 1,5 л кефира, пускай даже жирного, и все. Так можно потерять до 5 кг в неделю. Однако сидеть на одном кефире дольше 3-5 дней нельзя, иначе организм начнет страдать от истощения.

Режим для быстрого похудения

Жесткое ограничение пищи эффективно в короткой перспективе. Поэтому, садясь на один кефир или гречневую кашу, нужно быть готовыми к тому, что потерянные килограммы быстро вернутся. Но можно перестроить собственный рацион так, чтобы снизить вес и зафиксировать его на одном уровне плюс-минус 2 кг. Для этого следует питаться дробно: не большими порциями трижды в день, а маленькими дозами 5 раз. Также придется отказаться от всех калорийных продуктов:

  • газированных сладких напитков;
  • алкоголя;
  • десертов;
  • жареной и печеной картошки;
  • жирного красного мяса;
  • колбас и сосисок;
  • хлопьев, завтраков быстрого приготовления;
  • фаст-фуда;
  • сдобы и другой выпечки из белой пшеничной муки.

Основу рациона должны составить свежие овощи и фрукты, нежирная рыба и белое мясо, крупы за исключением белого риса. Полезно вести дневник питания, учитывая все приемы пищи, даже самые незначительные. Также следует рассчитать суточную норму калорий для своего веса и образа жизни, отнять от нее 300-500 единиц, и придерживаться именно такой калорийности.


Эффективные способы похудения

Кроме перечисленных методов экстренного снижения веса есть и другие.

Диета на 5 дней эффективная

«Лесенка» – методика снижения веса на 3-8 кг за 5 дней. Она опирается на пять ступеней питания, равные 5 дням недели:

  1. Очищающий день: голодание с регулярным употреблением чистой воды.
  2. Восстановительный: можно есть кисломолочные продукты.
  3. Энергетический: нужно порадовать организм глюкозой при помощи изюма, меда и других натуральных продуктов.
  4. Строительный: на этом этапе едим белок.
  5. Жиросжигающий: нужна клетчатка, которая насыщает и утоляет чувство голода.

Самая эффективная диета на неделю

Проще всего снизить за неделю вес при помощи рациона из одной гречневой каши и кефира. Да, получается однообразно, зато вы теряете до 5 кг. Гречку нужно готовить так же, как и для гречневой методики: запаривать, а не варить. В день выпиваем до 1,5 л нежирного кефира.


Эффективная диета на 10 дней

Суть супердиеты для похудения: в один день можно есть только один продукт в количестве до 1 кг. Длится похудение до 10 суток, так можно снизить около 8 кг. Однако врачи предупреждают: этот метод хоть и помогает снизить вес, но не безопасен для здоровья. Поэтому при первых признаках недомогания нужно обратиться к врачу. А чтобы избежать недомогания, придерживайтесь таких принципов:

  • выбирайте натуральные продукты;
  • исключите из рациона жирное, сладкое, копченое, красное мясо, алкоголь;
  • составьте расписание приема пищи и придерживайтесь его;
  • сократите количество соли, которое потребляете с едой.

Варианты продуктов, которые подходят для этого способа снижения веса: отварной картофель, свежая капуста, вареная свекла, сырая морковь. Также рекомендуют свежие огурцы, яблоки и отварной рис. Можно устраивать «кефирные» и «молочные» дни.

Можно попробовать и вегетарианский рацион. Это более безопасный вариант, но потеряете вы до 3 кг. Суть метода в питании одними овощами и фруктами, отказе от всех остальных блюд, включая сыры, яйца и молоко.


Диета на 2 недели эффективная

За четырнадцать чуток можно попробовать экстремальный способ потери веса, который заключается в практически полном отказе от еды. Съедать нужно совсем немного здоровой пищи, чтобы не возникало чувство насыщения. Вы постоянно будете испытывать голод, основные килограммы потеряете на первой неделе голодания, потом темпы снижения веса замедлятся.

Однако этот рацион подходит, мягко говоря, не всем. Голодание – стресс для организма, и у двухнедельного недоедания целый букет побочных эффектов. Поэтому мы рекомендуем менее радикальный способ нормализовать массу тела: уже знакомый рацион из одного продукта на один день. Его можно растянуть и на 14 дней, главное, не забывать пить до 2 литров воды в день и чередовать продукты.

Диета эффективная для похудения на месяц: меню продуктов

Сервис BeFit предлагает готовый недельный рацион и меню полезных продуктов, которые помогают нормализовать вес. Мы разработали сбалансированное и вкусное питание, вы будете не только худеть, но и наслаждаться полезной и аппетитной едой. Результат будет лучше, если комбинировать здоровый рацион с физическими нагрузками.


Самые эффективные диеты для похудения

Есть три вида способов снизить массу тела: жесткие, очищающие и щадящие. Мы советуем без крайней необходимости не прибегать к жестким методикам, потому что у них много побочных эффектов. Но если снизить вес нужно срочно, можно пробовать такой вариант: полный отказ от высококалорийной пищи и переход на низкокалорийный рацион. Максимальная калорийность суточная рациона – 1300 калорий. Чтобы избежать постоянного чувства голода, нужно при этом разделить еду на 7-8 приемов.

Более щадящий вариант: очищающий метод, который заключается в отказе от продуктов животного происхождения, а также жареных, жирных и копченых блюд. Их следует заменить овощами, фруктами, злаками, нежирными молочными продуктами. Но и в этом случае важно есть небольшими порциями 5 раз в сутки.

Щадящий рацион переносить легче всего, он рассчитан на потерю веса в течение месяца. Строгих ограничений нет, но высококалорийные продукты, фаст-фуд, десерты, сдобу, сладкие и газированные напитки нужно исключить полностью. Также отказываемся от жирного, жареного, копченого. Вместо этого едим черный и бездрожжевой хлеб, немного черствые несладкие булочки, масло, сельдерей, молоко, овощи и фрукты. Также можно питаться злаками, бобовыми, нежирным мясом и рыбой. Пьем зеленый чай, кефир, фруктовые соки. Но не из паков, а собственноручно выжатые!

Секреты легкой диеты

Для снижения веса важно сохранять мотивацию: помнить о своей цели. Также старайтесь сделать этот период приятным: не замыкайтесь, общайтесь, гуляйте на свежем воздухе, занимайтесь спортом. Не забывайте пить не меньше 2 литров чистой минеральной воды в сутки, питаться небольшими порциями, и тогда диетический рацион будет воспринимать легче.


Отзывы и результаты похудевших

Рацион от BeFit опробовали на себе многие девушки. Их опыт подтверждает: переход на сбалансированное питание – прямая дорога к подтянутой красивой фигуре!

Отзывы врачей и специалистов

Медики напоминают: безопасный для здоровья темп снижения массы тела – 0,5-1 кг в неделю. Можно худеть на 2 кг в неделю без последствий для внутренних органов, но более стремительные темпы – стресс для организма. Он не проходит бесследно, выливаясь в эндокринологические нарушения и болезни желудочно-кишечного тракта. К тому же, увлекаясь строгими рационами, можно попасть в ловушку расстройства пищевого поведения. Оно может выражаться как в компульсивных перееданиях, так и в боязни съесть что-нибудь вредное.

Поэтому врачи советуют не голодать, но сбалансировать свой рацион так, чтобы организм получал все необходимые питательные вещества. Если нужно снизить вес, дефицит калорий должен быть легким. Исследования показали, что безопасное сокращение рациона – не более чем на 25% калорий от нынешней порции.

Доставка полезной еды | Питание на неделю с доставкой отзывы | Правильное питание в офис доставка | Детокс на неделю доставка | Заказать рыбные блюда | Комплекс для снижения веса | Доставка готового спортивного питания | Доставка готовой вегетарианской еды

Какая диета самая эффективная с точки зрения похудения: мнение эксперта

Michael Hedge / Men's Health

«Этим вопросом ежедневно задаются миллионы людей, решивших наконец-то привести себя в форму, избавиться от избыточной массы тела и поправить своё здоровье, – говорит врач-эндокринолог Павел Баранов. – Поскольку есть такой большой спрос, то есть и предложение: с каждым годом появляется всё больше и больше новых (а иногда и хорошо забытых старых) типов питания, подразумевающих те или иные ограничения в рационе».

РЕКЛАМА – ПРОДОЛЖЕНИЕ НИЖЕ

Разнообразие диет

Иногда эти типы питания весьма приемлемы и рациональны, а иногда далеки от адекватности и не имеют ничего общего с понятием «здоровье». Как бы то ни было, во всём мире уже не первый год идут споры между сторонниками различных типов питания. И каждый говорит о преимуществах и эффективности своего личного выбора.

«Но важно помнить одно, – отмечает эксперт, – когда речь идёт о снижении массы тела, работать будет абсолютно любая диета, подразумевающая ограничение потребляемой энергии. Что именно ограничивать – решаете только вы. Чем комфортнее выбранный вами тип ограничений, тем выше вероятность того, что в итоге вы всё же добьётесь поставленной цели».

РЕКЛАМА – ПРОДОЛЖЕНИЕ НИЖЕ

LCHF (Low Carb High Fat)

Тип питания, подразумевающий снижение энергетической ценности рациона за счёт ограничения количества потребляемых углеводов. Если вы соблюдаете LCHF с целью похудения, ваш рацион формируется в основном за счёт белков и жиров, при этом энергия из углеводов составляет не более 20-25% от всех потребляемых вами калорий.

Вегетарианство, веганство

Питание, при котором снижение энергетической ценности рациона осуществляется за счёт ограничения количества продуктов животного происхождения. Ваш рацион формируется в основном за счёт растительной пищи, а наличие/отсутствие животных продуктов диктуется разновидностью диеты:

РЕКЛАМА – ПРОДОЛЖЕНИЕ НИЖЕ

  • пескетарианство (включает рыбу, яйца, молочные продукты, исключает мясо)
  • оволактовегетарианство (включает яйца и молочные продукты)
  • лактовегетарианство (включает молочные продукты)
  • ововегетарианство (включает яйца)
  • веганство (исключает любые животные продукты)

(Читайте также: 3 самых эффективных жиросжигателя, которых вы не купите в магазине спортпита.)

Интервальное голодание

Схема питания, предполагающая уменьшение энергетической ценности рациона за счёт ограничения времени, в течение которого вы можете есть. Если вы соблюдаете ИГ с целью похудения, ваш рацион никак не ограничивается с точки зрения продуктов питания, а снижение калорийности достигается за счёт сокращения времени на еду.

РЕКЛАМА – ПРОДОЛЖЕНИЕ НИЖЕ

Палео (диета пещерного человека)

Тип питания, при котором снижение энергетической ценности еды происходит за счёт исключения продуктов промышленного производства. Рацион состоит только из цельных продуктов – мясо, птица, рыба, яйца, фрукты, овощи, ягоды, орехи, семечки – всё остальное исключается.

Кето (кетогенная) диета

Этот тип питания подразумевает снижение энергетической ценности рациона за счёт практически полного исключения углеводов и ограничения белков. Если вы соблюдаете кето с целью похудения, снижение калорийности рациона происходит путём исключения всей углеводной пищи, а также умеренной доли белка в рационе.

(Читайте также: Можно ли макароны на диете: мнение диетолога.)

РЕКЛАМА – ПРОДОЛЖЕНИЕ НИЖЕ

Карнивор (плотоядная диета)

Это тип питания, который предполагает снижение энергетической ценности рациона путём полного исключения вообще всей растительной пищи. Если вы соблюдаете карнивор, калорийность рациона снижается за счёт полного отсутствия в рационе углеводов, а также всех существующих белков и жиров растительного происхождения.

Средиземноморская диета

Тип питания, при котором снижение энергетической ценности рациона осуществляется за счёт ограничения количества пищи, при этом основу рациона составляют овощи, фрукты, злаки, зерновые, рыба, масла, молочные продукты, яйца, морепродукты, мясо. Данный тип питания является самым сбалансированным из всех популярных.

РЕКЛАМА – ПРОДОЛЖЕНИЕ НИЖЕ

(Читайте также: Что такое DASH-диета и в чём её польза.)

В итоге важно лишь одно

Обратите внимание, какой бы тип питания вы ни выбрали, избавление от жира будет осуществляться за счёт создания дефицита энергии.

«Если ваша цель – похудеть, вы можете соблюдать любой вариант диеты из всех существующих. Любая диета с ограничением энергетической ценности рациона работает в плане снижения массы тела. Выбирайте такой тип питания, который будет наиболее комфортный именно для вас, ведь чем лучше вы придерживаетесь плана, тем лучше будет результат, – считает Павел Баранов. – Однако с точки зрения здоровья самой сбалансированной из всех перечисленных является средиземноморская диета».

Читайте так же по теме:

Как сделать процесс похудения более комфортным: 5 простых советов.

10 важных уроков от человека, который сбросил 65 килограмм.

3 совета, которые помогут избежать срывов на диете.

Диета № 1 (Щадящая диета)

Рекомендуемые продукты и блюда Исключаемые продукты и блюда
Хлеб пшеничный из муки высшего и 1-го сорта
вчерашней выпечки или подсушенный, печенье
сухое, сухой бисквит, несдобные булочки
Ржаной и любой свежий хлеб, изделия из слоеного теста
Супы из разрешенных протертых овощей
на морковном, картофельном отваре,
молочные супы из хорошо разваренных круп,
молочные супы-пюре из овощей, супы-пюре
из заранее вываренных кур или мяса,
из протертых сладких ягод с манной крупой
Мясные и рыбные бульоны, грибные и крепкие отвары, щи, борщи, окрошка
Нежирные сорта мяса, без кожи у птиц, паровые
и отварные блюда из говядины, молодой нежирной баранины и обрезной свинины, кур, индейки,
паровые котлеты, биточки, кнели, суфле, пюре, зразы, бефстороганов из вареного мяса
Жирные или жилистые сорта мяса животных и птиц (утки, гуся), консервы, копчености
Нежирные виды рыб без кожи, куском или в виде котлетной массы, сваренной в воде или на пару Копченая и соленая рыба, консервы
Молоко, сливки, некислый кефир, простокваша,
ацидофилин, йогурт, творог и сметана,
запеченные сырники, ленивые вареники, пудинги,
неострый сыр тертый
Молочные продукты с высокой кислотностью, острые, соленые сыры
Яйца 2-3 шт в день, всмятку, паровой омлет Яйца, сваренные вкрутую и жареные
Рис, гречневая, манная и овсяная крупы,
каши, сваренные на молоке или воде,
полувязкие и протертые
Кукурузная крупа, бобовые
Картофель, морковь, свекла, цветная капуста,
ограниченно-зеленый горошек, сваренные на пару
или в воде и протертые, спелые некислые томаты
Белокочанная капуста, репа, редька, щавель, шпинат, лук, огурцы, соленые, квашеные и маринованные овощи, грибы
Салат из отварных овощей, мяса, рыбы,
язык отварной, паштет из печени, икра осетровых, колбаса докторская, молочная, диетическая
Острые и соленые закуски, консервы, копчености
В протертом, вареном и печеном виде сладкие ягоды и фрукты, кисели, желе, зефир, пастила, молочный кисель, компоты, снежки Кислые, недостаточно спелые, богатые клетчаткой фрукты и ягоды, не протертые сухофрукты, шоколад, мороженое
Молочные соусы без пассеровки муки
с добавлением сливочного масла, сметаны,
фруктовые, молочно-фруктовые, ограниченно -
укроп, петрушка, ванилин, корица
Мясные, рыбные, грибные, томатные соусы, хрен, кетчуп, горчица
Некрепкий чай, чай с молоком, сливками,
слабые какое и кофе с молоком, сладкие соки
из фруктов и ягод, отвар шиповника
Газированные напитки, квас, черный кофе
Сливочное несоленое масло, коровье
топленое высшего сорта, рафинированные
растительные масла
Другие жировые продукты

Кетогенная диета при эпилепсии у детей и для взрослых. Рецепты и меню.

Суть действия диеты заключается в том, что при переваривании пищи жиры превращаются в специфические продукты обмена — кетоновые тела, которые, попадая в головной мозг, обеспечивают противосудорожный эффект. Именно поэтому диету и называют кетогенной – она ведет к продуцированию в организме кетонов, являющихся, по сути, лечебным средством при эпилепсии. Эта диета – не для того, чтобы худеть, а для того, чтобы бороться с болезнью.

Лечебная диета подразумевает потребление от 3 до 4 граммов жира на каждый грамм белков и углеводов. Несмотря на то, что белки и углеводы должны потребляться в умеренных количествах, необходимо обеспечивать организм достаточным количеством белка.3 Для того чтобы найти оптимальное для конкретного случая соотношение питательных веществ, необходимо проконсультироваться с лечащим врачом и профессиональным диетологом. В ходе лечения изначально подобранный рацион может корректироваться врачом в соответствии с состоянием пациента.

Питание при эпилепсии должно включать в себя различные виды жирных продуктов, таких как, например, сливочное масло, бекон, жирные сливки, растительные масла, майонез. В странах, где диета с увеличенным содержанием жиров нашла широкое применение в питании, пищевая промышленность выпускает множество специальных продуктов, чтобы обеспечить разнообразное меню.1

Так как потребление сахара в меню кетогенной диеты максимально ограничено, больным эпилепсией следует быть осторожными при приёме содержащих сахар лекарств (например, сиропов от кашля), витаминов, при использовании зубных паст, содержащих сахар, и других непродовольственных и продовольственных товаров, которые могут содержать сахар.3 Следует внимательно читать описания состава при приобретении средств гигиены.

Назначается диета, как правило, при формах эпилепсии, устойчивых к воздействию лекарственных средств-антиконвульсантов. Как и любая другая, эта диета имеет свои противопоказания. К ним относятся:

  • Функциональные нарушения в работе сердца, печени, почек;
  • Наличие текущих энцефалопатий;
  • Митохондриальные заболевания;
  • Заболевания эндокринного характера (например, сахарный диабет)

Кроме того, относительным противопоказанием может быть необходимость хирургического вмешательства.4

Лучшие и худшие диеты для похудания, здоровья сердца и многого другого

Диета Голо Диета Голо может привести к некоторой начальной потере веса, но это, вероятно, потому, что она ограничивает потребление калорий - и неясно, помогло ли это by Release, запатентованную добавку на растительной основе, которую Golo продает на своем веб-сайте (от 49,95 долларов США за 30-60-дневную поставку).

Некоторые предварительные данные свидетельствуют о том, что отдельные компоненты этой добавки могут оказывать положительное влияние на жировые клетки тела и уровень глюкозы, но недостаточно проверенных и контролируемых исследований, доступных по диете Голо или ее добавке Release, чтобы доказать, что они могут привести к похуданию.(На своем веб-сайте Golo действительно перечисляет четыре исследования, которые показывают, что эта диета может привести к потере веса, но эти исследования были относительно слабыми, потому что они не включали контрольную группу, и поскольку все они были проведены Golo, существует высокий потенциал за предвзятость результатов исследования

) В общем, будьте осторожны с любой диетой, которая включает волшебную таблетку.

Узнайте больше о диете Голо

The Shibboleth Diet В этой программе, основанной на членстве, вы будете выбирать блюда в соответствии со списком одобренных продуктов, включая множество объективно здоровых фруктов, овощей, цельнозерновых продуктов, нежирный белок и молочные продукты с низким или обезжиренным содержанием жира.

Тем не менее, план питания Shibboleth не был разработан квалифицированными экспертами, и нет никаких доказательств его утверждения о том, что он «взломал код взрослого и детского ожирения».

Используемые выражения, такие как «жирный автобус» или «ваш идеальный вес», могут вызывать у одних отталкивающее и позорное тело, в то время как другие могут не соглашаться с тем, что «без отношений со Христом не может быть долгого времени». -срочный успех ».

Более того, план Shibboleth, основанный на членстве, обойдется вам в ежемесячную плату в размере 9 долларов США.95, что может отпугнуть некоторых.

Узнайте больше о диете Шибболет

Метод Майра Метод Майра привлек внимание после того, как актер Ребел Уилсон приписал ему недавнюю потерю веса. Чтобы следовать этому плану питания, вам необходимо записаться на проживание на одном из роскошных курортов VivaMayr, где тренеры пропишут вам «лекарство», основанное на четырех принципах: медицина, питание, упражнения и осведомленность.

Этот целостный подход к снижению веса может сочетать такие процедуры, как кислородная терапия, консультации по питанию, водный велосипед и индивидуальные тренировки, согласно их веб-сайту, хотя индивидуальные процедуры будут варьироваться в зависимости от вашего выбора плана.

При этом, для большинства людей это невыполнимый план снижения веса, в основном потому, что вам нужно будет поехать в клинику Mayr, чтобы получить лечение, которое может быть дорогостоящим, трудоемким и с учетом ограничений на поездки во время лечения. COVID-19 пандемия. Более того, хотя вы, вероятно, добьетесь прогресса в таком иммерсивном ретрите, может быть трудно поддерживать потерю веса после того, как ретрит закончится и вы вернетесь к своему обычному распорядку дня. И последнее, но не менее важное: многие методы лечения, о которых сообщалось на этих ретритах, в том числе слабительные, не являются безопасным способом похудеть, предупреждают некоторые эксперты.

Узнать больше о методе Майра

Sirtfood Diet Этот план питания стал популярным в 2020 году после того, как певица Адель опубликовала фотографию своего резкого похудания в Instagram, а СМИ, в том числе People , сообщили что она трансформировала на нем свое тело.

Но что это за 411 на этом плане? Во-первых, он назван в честь сиртуинов, семейства белков, участвующих в ряде метаболических функций, согласно статье в Molecular Endocrinology .

Сторонники этой двухфазной диеты утверждают, что увеличение потребления сиртуинов за счет продуктов, богатых полифенолами, таких как капуста и темный шоколад, активирует пути «генов худости» и приведет к потере веса.

На первом этапе вы сосредоточитесь на том, чтобы ограничиться одним приемом пищи в день и пить много зеленого сока (сок, рекомендованный Sirtfood, содержит несколько ингредиентов, включая капусту, рукколу, имбирь и матча

). Через несколько дней вы перейдете к двухразовому питанию и добавите две порции зеленого сока.На втором этапе вы потратите две недели на три приема пищи, ориентированные на Sirtfood, вместе с одним зеленым соком в день. По истечении трех недель вам рекомендуется продолжать есть продукты, богатые сиртуином, и пить зеленый сок, но вы можете постепенно снова включать в свой рацион другие одобренные продукты. больше связано с тем, что вы ограничиваете калории на первом этапе плана. Но при 1000 калорий в день (а позже и 1500 калорий в день) вы опускаетесь ниже рекомендаций Министерства сельского хозяйства США по ежедневному потреблению калорий

и можете испытывать голод, умственный туман и усталость.И хотя сторонники этой диеты рекламируют сиртуины как ключ к похуданию, исследований, подтверждающих их утверждения, недостаточно. Вы можете наслаждаться многими из предполагаемых преимуществ диеты Sirtfood, просто питаясь с упором на продукты растительного происхождения и богатые антиоксидантами.

Подробнее о диете Sirtfood

Дополнительный отчет сделали Бонни Тауб-Дикс, Шерил Хаггинс Саломон, Кэти Робинсон, Джессика Мигала, Мелинда Карстенсен и Лаура МакАрдл.

3 миллиарда человек не могут позволить себе здоровое питание

CC BY-ND

Пандемия COVID-19 вызвала скачок цен на кукурузу, молоко, бобы и другие товары, но даже до пандемии около 3 миллиардов человек не могли позволить себе даже самые дешевые варианты здорового питания.

Недавний анализ данных о мировых ценах на продовольствие показывает, что по состоянию на 2017 год, последний год, по которому имеются данные, около 40% населения мира уже были вынуждены потреблять некачественные диеты из-за сочетания высоких цен на продукты питания и низких доходов. Когда здоровые продукты недоступны по цене, люди не могут избежать недоедания и связанных с диетой заболеваний, таких как анемия или диабет.

Остальные 60% из 7,9 миллиарда человек в мире могут позволить себе продукты для здорового питания.Это, конечно, не означает, что они всегда придерживаются здоровой диеты. Время и сложность приготовления, а также реклама и маркетинг других продуктов питания могут побудить многих людей выбирать продукты, которые на удивление вредны для здоровья.

Различение доступности и других причин нездорового питания - ключевой шаг к лучшим результатам, который стал возможным благодаря исследовательскому проекту, который мы возглавляем в Университете Тафтса, под названием «Цены на питание для питания». Проект дает новый взгляд на то, как сельское хозяйство и распределение продуктов питания связаны с потребностями здоровья человека, связывая экономику с питанием в сотрудничестве с группой данных развития Всемирного банка и Международным институтом исследований продовольственной политики.

Чтобы измерить стоимость диеты в глобальном масштабе, наш проект связал данные Всемирного банка о ценах примерно на 800 популярных продуктов питания в 174 странах с питательным составом этих продуктов. Используя цены и пищевую ценность каждого продукта, мы вычислили наименее затратный способ соблюдения национальных диетических рекомендаций и требований к основным питательным веществам.

Что касается доступности, мы сравнили расходы на питание с оценками Всемирного банка, которые люди обычно тратят на питание и распределение доходов в каждой стране.Оказывается, почти каждый в Соединенных Штатах мог позволить себе достаточно ингредиентов для здорового питания, таких как рис и бобы, замороженный шпинат и консервированный тунец, хлеб, арахисовое масло и молоко. Но большинство людей в Африке и Южной Азии не смогли бы получить достаточно этих продуктов для здорового питания, даже если бы они были готовы потратить весь свой доступный доход.

Цены на продукты питания растут и падают, но многие здоровые продукты, такие как фрукты и овощи, орехи, молочные продукты и рыба, постоянно дороже крахмалистых продуктов питания, масла и сахара.Высокая стоимость более здоровых продуктов питания часто вынуждает людей, живущих в бедности, есть менее дорогие продукты или голодать.

Что можно сделать?

Страны могут позволить каждому позволить себе здоровое питание за счет создания большего количества высокооплачиваемых рабочих мест и расширения социальной защиты для людей с низкими доходами. Например, в США действует Программа дополнительной помощи в области питания, или SNAP, которая помогает американцам с низким доходом покупать некоторые из необходимых им продуктов питания. Программы социальной защиты такого типа снижают уровень продовольственной безопасности, защищают рабочие места во время экономических спадов и особенно важны для развития детей.

Помимо более высоких доходов и системы социальной защиты для самых бедных, цены на продукты питания могут быть снижены для всех за счет государственных инвестиций в новые технологии и инфраструктуру для улучшения производства и распределения продуктов питания. Сельскохозяйственные инновации и инвестиции в продовольственные рынки могут спасти жизни и стимулировать экономическое развитие - когда новые технологии и другие изменения хорошо адаптированы к местным условиям.

[ Понравилось то, что вы прочитали? Хочу больше? Подпишитесь на ежедневную рассылку новостей The Conversation.]

Мы считаем, что наши данные о стоимости рациона, подготовленные для информирования о глобальной сельскохозяйственной политике, позволяют людям по-новому взглянуть на мировую продовольственную ситуацию. Предыдущие усилия по мониторингу мировых цен на продовольствие были сосредоточены на отслеживании нескольких сельскохозяйственных товаров, продаваемых на международном рынке, мониторинге условий в местах, подверженных риску голода, или отслеживании индексов потребительских цен. Измерение стоимости здорового питания с использованием продуктов, доступных на местном уровне, позволяет сосредоточить внимание на потребительских ценах на здоровые продукты питания, которые люди с низким доходом могли бы покупать, если бы эти продукты были доступными.

Имея более точные данные, правительства и агентства по развитию могут направить свои страны туда, куда они хотят, что в один прекрасный день позволит всем во всем мире придерживаться здоровой диеты.

Экономист Всемирного банка Ян Бай внес свой вклад в это исследование.

Патриотов Новой Англии Лоуренс Гай: веганская диета продлила мою карьеру - Блог Патриотов Новой Англии

ФОКСБОРУ, Массачусетс - Патриоты Новой Англии начинают защищаться Лоуренс Гай на другом конце телефона и обсуждает, как он готовится его обеды к началу тренировочного лагеря 28 июля.

Спагетти из тыквы.

Жареные оладьи из цветной капусты.

Кабачки спиральные.

Чипсы из брокколи.

Сапожник из сырых персиков.

Зеленый коктейль с морковью, нутом, капустой и шпинатом.

Фасоль и киноа.

Гай, 31 год, увлечен своей преимущественно веганской диетой. Настолько страстный, что он считает, что это главный фактор того, как он продержался 10 сезонов в НФЛ и смог подписать четырехлетний контракт в марте с базовой стоимостью 11 долларов.5 миллионов и гарантированные 4 миллиона долларов.

«Я много лет ел веганскую пищу в межсезонье», - сказал Гай, определив 2012-2013 годы в качестве отправной точки, а его жена Андреа вела его в этом направлении. «Для меня это аспект замены вещей на более здоровый образ жизни. Это помогло мне полностью восстановиться и просто вымыть тело.

« На этом поле тебя бьют каждый день. Ваше тело нуждается в питании больше, чем когда-либо, для восстановления. Как лучше всего это сделать? Я думаю, что это на растительной основе.Все, что вы делаете, - это определенным образом продлеваете свою карьеру ».

Защитный захват Лоуренс Гай попал в выбранную СМИ команду All-Decade 2010s Patriots. Фото Джорджа Уокера / Icon Sportswire

Гай, который был выбран первым капитан «Патриотов» в 2020 году, автор рассказа об аутсайдерах из штата Аризона. Он был выбран «Грин Бэй Пэкерс» в седьмом раунде драфта 2011 года и провел первые годы своей карьеры в составе травмированного резерва и тренировочной команды. прежде, чем прыгать с Индианаполисом Кольтс (2012-13), затем Сан-Диего Чарджерс (2013-14) и Балтимор Рэйвенс (2014-16).

Патриоты определили его как недооцененный актив и подписали с ним четырехлетний контракт на 20 миллионов долларов в 2017 году. Гай ростом 6 футов 4 315 фунтов затем провел впечатляющую четырехлетнюю работу, которая принесла ему место. о выбранной СМИ команде всех десятилетий Patriots 2010s.

Прибытие Гая в Новую Англию совпало с важными изменениями в его веганской диете.

«Когда я пришел туда, у меня было, вероятно, 300 фунтов. Зная позицию, в которой я играл, и стиль, в котором они играют, я знал, что мне нужно набрать немного больше веса», - объяснил он.«Я не из тех людей, которые борются за снижение веса, но всегда сложно набрать больше веса. Поэтому, когда наступает тренировочный лагерь, я должен следить за тем, сколько я ем, чтобы поддерживать вес, потому что я совсем не хочу падать ".

В номинациях на ESPYS 2021 года полно игроков НФЛ. Отдайте свои голоса сегодня.

Лучший спортсмен, мужской спорт
• Том Брэди - лучший игрок НФЛ

Лучший игрок НФЛ
• Брэди, Роджерс, Дональд или Генри?

Лучшая команда
• Сможет ли Тампа Бэй выиграть титул?

Лучшая игра
• Магия Мюррея и Меткалфа

Лучший спортсмен-прорыв
• Герберт и Янг среди номинантов

Лучшая игра
• Помни воронов

Гай считает, что ресторан, специализирующийся на веганской кухне, играет важную роль.Ему нравится видеть полные рецепты, определяя те, которые помогают ему поддерживать вес, по сравнению с теми, которые могут способствовать похуданию. Он также ценит гибкость при замене определенных ингредиентов (например, он не фанат тофу).

Такая замена часто вызывает разговоры с его товарищами по команде «Патриотов», такими как линейный игрок защиты Деатрих Уайз-младший и квотербек Кэм Ньютон.

Гай недавно подарил Уайзу, который также придерживался веганской диеты, кулинарную книгу некоторых из своих любимых рецептов.

«У нас был часовой разговор о том, какие веганские блины лучше всего -« эта смесь лучше той ». И мы нашли фотографии в нашей кладовой, - сказал Гай со смехом.

Что касается Ньютона, разговор начался, когда Гай сказал ему, что у него есть дополнительный заменитель мяса на растительной основе, который не поместится в его морозильной камере, и ему было любопытно, хочет ли Ньютон этого. Ньютон, который публично пропагандировал преимущества веганской диеты, сказал Гаю, что его суставы не так сильно болят.

Парень сам заметил то же самое, кроме того, что у него больше энергии.

«Я решил больше перейти на веганскую диету, чтобы полностью выздороветь. Растительный белок - это потрясающе, что вы можете сделать. Вам не нужен животный белок все время, чтобы набраться сил и выздороветь», он сказал.

«Белок курицы, рыбы, коровы или бизона, ваше тело должно его расщепить. Но когда дело доходит до этих овощей и злаков, организму не нужно так сильно и сильно расщепляться, поэтому он постоянно получает вся пища из него ".

Гай не называет себя «полным веганом», потому что бывают случаи, когда он включает мясо в свой рацион, что, по его словам, является результатом его позиции в качестве защитного средства.

Но его страсть к этой теме - например, простое решение заменить чипсы свежим перцем, нарезанным ломтиками в качестве закуски - является результатом того, как он считает, что это изменило его жизнь.

«Раньше я ел так много мяса, что у меня было вздутие живота. Как только я заменил его другими продуктами, вздутие живота вышло», - сказал он. «Поэтому я всегда говорю людям:« Не бойтесь пробовать что-то новое ». Никогда не знаешь, что меняет жизнь ".

Изофлавоновая диета улучшает экспериментальный аутоиммунный энцефаломиелит за счет модуляции количества кишечных бактерий, истощенных у пациентов с рассеянным склерозом.

Abstract

Микробиота кишечника является потенциальным фактором окружающей среды, влияющим на развитие рассеянного склероза (РС).Мы и другие продемонстрировали, что пациенты с рассеянным склерозом и здоровые люди имеют разные микробиомы кишечника. Однако патогенетическая значимость этих различий остается неясной. Ранее мы показали, что бактерии, метаболизирующие изофлавоны, менее многочисленны у пациентов с РС, предполагая, что бактерии, метаболизирующие изофлавоны, могут обеспечивать защиту от РС. Здесь, используя мышиную модель рассеянного склероза, мы сообщаем, что изофлавоновая диета обеспечивает защиту от болезней, которые зависят от присутствия бактерий, метаболизирующих изофлавоны, и их метаболитного эквола.Примечательно, что состав кишечного микробиома мышей, получавших изофлавоновую диету, демонстрировал параллели со здоровыми донорами-людьми, тогда как состав у тех, кто получал диету без изофлавонов, демонстрировал параллели с пациентами с РС. В совокупности наше исследование предоставляет доказательства того, что микробные изменения кишечника, вызванные диетой, уменьшают тяжесть заболевания и могут способствовать патогенезу рассеянного склероза.

ВВЕДЕНИЕ

Рассеянный склероз (РС) - хроническое нейровоспалительное заболевание центральной нервной системы (ЦНС), которое приводит к сенсорной, моторной и / или когнитивной дисфункции ( 1 ).Это происходит из-за сложного взаимодействия генетических факторов и факторов окружающей среды, которые запускают активацию аутореактивных Т-клеток, что приводит к последующей инфильтрации иммунных клеток в ЦНС, нейродегенерации и повреждению аксонов ( 2 ). На сегодняшний день генетическое влияние на рассеянный склероз хорошо охарактеризовано, например, сильная ассоциация определенных гаплотипов человеческого лейкоцитарного антигена (HLA) с заболеванием ( 3 ). Напротив, роль факторов окружающей среды, на которые приходится около 70% риска заболеваний, остается малоизученной ( 4 , 5 ).В последнее время микробиом кишечника стал потенциальным фактором окружающей среды, который в конечном итоге может дать важные ключи к разгадке патогенеза и регуляции рассеянного склероза. Понимание роли кишечных микробов в течении болезни может привести к возможным вмешательствам в виде диеты, пробиотиков и / или передовых комбинаторных методов лечения пациентов с рассеянным склерозом.

За последнее десятилетие технология профилирования и секвенирования микробиома, не зависящая от культуры, ясно продемонстрировала, что микробиом кишечника влияет на здоровье и болезни ( 6 ).Кишечные бактерии позволяют хозяину получать больше энергии из пищи, участвуя в расщеплении неперевариваемых пищевых соединений на продукты распада, которые могут оказывать как иммуномодулирующее, так и противовоспалительное влияние на иммунную систему хозяина ( 7 , 8 ). У пациентов с РС некоторые бактерии либо обогащены, либо истощены по сравнению со здоровым контролем, что указывает на дисбактериоз кишечника у этих пациентов ( 9 - 17 ). Таким образом, микробиом кишечника стал потенциальным фактором, который может влиять на течение заболевания, но остается неясным, вносят ли различия в численности конкретных бактерий вклад в патобиологию РС.

У человека некоторые кишечные бактерии переваривают фитоэстрогены, которые представляют собой соединения растительного происхождения, напоминающие эстроген. Изофлавоны - это основной класс фитоэстрогенов, которых очень много в бобовых, таких как соя ( 8 ). Однако люди не содержат необходимых ферментов для расщепления изофлавонов и, таким образом, полагаются на микробиоту кишечника для сбора этих биологически активных метаболитов ( 18 , 19 ). Примечательно, что исследования нашей и других групп показали, что количество бактерий, метаболизирующих изофлавоны, уменьшается у пациентов с РС по сравнению со здоровыми людьми, что позволяет предположить, что эти соединения могут обладать противовоспалительными свойствами, ограничивающими болезнь ( 9 , 16 ).Хотя изофлавоны известны своими антиоксидантными и противовоспалительными свойствами при сердечно-сосудистых заболеваниях и раке, влияние этих соединений на патогенез и тяжесть рассеянного склероза, особенно в контексте микробиома кишечника, остается неуловимым ( 18 , 20 ).

В настоящем исследовании мы демонстрируем, что экспериментальный аутоиммунный энцефаломиелит (EAE) подавляется у мышей, получавших диету с добавлением изофлавонов. Кроме того, состав микробиома кишечника мышей на изофлавоновой диете демонстрировал параллели с составом здоровых людей, тогда как микробиом кишечника тех, кто получал диету без изофлавонов, демонстрировал параллели с таковым у пациентов с рассеянным склерозом.Примечательно, что мы показываем, что определенные бактерии, которые отсутствуют у пациентов с РС, ответственны за защиту от EAE, обеспечиваемую изофлавоновой диетой. В совокупности эти результаты демонстрируют, что на тяжесть / развитие EAE влияет как диета, так и возникающие в результате изменения в составе микробиома кишечника.

РЕЗУЛЬТАТЫ

Изофлавоновая диета улучшает EAE на нескольких моделях мышей

Пациенты с РС демонстрируют пониженное количество кишечных бактерий, способных метаболизировать изофлавоны, что позволяет предположить, что неспособность переваривать эти соединения может способствовать или обострять болезнь ( 9 , 16 ).В соответствии с этим, распространенность РС является низкой в ​​странах, граждане которых потребляют большое количество изофлавонов (от 10 до 30 мг / день), таких как Китай и Япония, по сравнению с западными странами, где потребление изофлавонов намного ниже (от 0,1 до 1 мг. / сутки) ( 21 ). Таким образом, мы предположили, что потребление диеты, богатой изофлавонами, обеспечит защиту от аутоиммунного воспаления в ЦНС, тем самым изменяя течение EAE. Чтобы решить эту проблему, мы поместили самок мышей C57BL / 6J на диету, содержащую изофлавоны или одну с недостатком изофлавонов, в течение 6 недель, а затем индуцировали ЕАЕ с использованием эпитопа миелинового олигодендроцитарного гликопротеина (MOG), пептида MOG 35-55 , эмульгированного в полном адъюванте Фрейнда ( CFA; MOG 35-55 / CFA) (рис.1A и таблица S1). Мыши, получавшие диету без изофлавонов, демонстрировали устойчивое и тяжелое течение болезни, тогда как у мышей, которые потребляли диету, содержащую изофлавоны, оно значительно уменьшалось (рис. 1B). Кроме того, клиническое заболевание EAE сравнивалось с мышами, получавшими «нормальный корм» - стандартную пищу для мышей, доступную в Университете штата Айова, которая содержит умеренные уровни изофлавонов (см. «Материалы и методы»). Мыши, получавшие нормальный корм, демонстрируют промежуточный фенотип EAE между мышами, получавшими изофлавоновую диету и диету без изофлавонов (рис.1, A и B), хотя частота EAE была одинаковой во всех диетических группах (рис. 1C). Кроме того, гистологическое исследование срезов спинного мозга после иммунизации показало, что инфильтраты воспалительных клеток были увеличены у мышей, получавших диету без изофлавонов, тогда как только минимальные инфильтраты наблюдались у мышей, получавших изофлавоны (рис. 1D).

Рис. 1. Изофлавоновая диета облегчает течение болезни на множестве моделей ЕАЕ на мышах.

( A ) Схема экспериментального дизайна.Самок мышей в возрасте от четырех до шести недель помещали на указанную диету на 6 недель перед иммунизацией MOG 35-55 / CFA или PLP 139-151 / CFA для индукции EAE. Мышей умерщвляли через 15-30 дней после иммунизации и собирали спинной мозг для анализа. ( B ) Сравнение средних клинических показателей у мышей C57BL / 6, получавших изофлавоновую диету, диету без изофлавонов или диету «нормальный корм». График справа отображает анализ соответствующей AUC для мышей без изофлавонов, мышей с изофлавонами и мышей с нормальным кормлением.( C ) Различные метрики EAE для клинических оценок EAE в (B). ( D ) Типичное окрашивание гематоксилином и эозином срезов спинного мозга мышей на (B). Топ, изофлавоновая диета; внизу, диета без изофлавонов, оцениваемая полуколичественным способом. Масштабные линейки 200 мкм и 50 мкм (вставка). График отображает средний балл по спинному мозгу, определенный, как описано в разделе «Материалы и методы». Столбцы представляют собой среднее значение и стандартную ошибку данных для каждой экспериментальной группы. Данные представляют три независимых эксперимента с тремя-пятью мышами в группе.( E и F ) Сравнение средних клинических показателей у мышей (E) AE ° .DR2 или (F) мышей SJL / J, получавших диету, не содержащую изофлавонов или изофлавонов. График справа отображает анализ соответствующей AUC. Столбцы представляют собой среднее значение и стандартную ошибку данных для каждой экспериментальной группы. Данные представляют три независимых эксперимента с пятью мышами в группе. Значение P определяли с помощью двустороннего дисперсионного анализа (ANOVA) для клинических оценок EAE и теста Стьюдента t для анализа AUC.* P <0,05, ** P <0,01, *** P <0,001 и **** P <0,0001.

Популяционные исследования показывают, что люди с аллелем HLA-DR2 демонстрируют повышенную частоту рассеянного склероза ( 22 ). Поэтому мы стремились определить влияние изофлавоновой диеты на трансгенных самок мышей AE ° .DR2, которые экспрессируют человеческий HLA-DR2 на негативном фоне класса II главного комплекса гистосовместимости (MHC) ( 23 ). Эта модель мыши позволяет нам исследовать EAE у мыши, которая более точно имитирует человеческий MS.Используя тот же экспериментальный план, что и для мышей C57BL / 6J, мы наблюдали снижение тяжести EAE у мышей AE ° .DR2 на изофлавоновой диете по сравнению с мышами, соблюдающими диету без изофлавонов, несмотря на тот факт, что ответ на антиген MOG несколько уменьшается в этой модели (рис. 1E). Учитывая, что у 85% пациентов с РС наблюдается ремиттирующая форма заболевания, мы также хотели определить влияние изофлавоновой диеты в этом контексте. Поэтому мы использовали самок мышей SJL / J, у которых развивается рецидивирующе-ремиттирующая картина заболевания при введении эпитопа протеолипидного белка миелина (PLP), PLP 139-151 , пептида, эмульгированного в CFA для индукции EAE.Подобно другим протестированным моделям, мы обнаружили, что мыши, соблюдающие изофлавоновую диету, также проявляют легкое заболевание по сравнению с мышами, соблюдающими диету без изофлавонов (рис. 1F). Таким образом, на нескольких моделях аутоиммунного воспаления в ЦНС наши результаты демонстрируют, что присутствие изофлавонов в рационе значительно снижает тяжесть заболевания EAE.

Изофлавоновая диета снижает клеточную инфильтрацию в ЦНС после EAE

Отличительной чертой MS и EAE является провоспалительная клеточная инфильтрация в ЦНС ( 24 ).Миелин-специфические CD4 + Т-клетки, которые продуцируют интерферон-γ (IFN-γ), интерлейкин-17A (IL-17A) и / или гранулоцитарно-макрофагальный колониестимулирующий фактор (GM-CSF), инфильтрируют ЦНС и имеют решающее значение в управлении воспалением и демиелинизацией ( 25 ). Чтобы определить влияние изофлавоновой диеты на инфильтрацию CD4 + Т-клеток в ЦНС после индукции ЕАЕ, мы поместили самок мышей C57BL / 6J на диету без изофлавонов или без изофлавонов на 6 недель, вызвав ЕАЕ с помощью MOG 35 -55 / CFA, и профили лимфоцитов в ЦНС через 20 дней после иммунизации (рис.2А). В соответствии со сниженной тяжестью заболевания у мышей на изофлавоновой диете наблюдалось меньшее количество инфильтрирующих CD4 + Т-клеток в ЦНС по сравнению с мышами, соблюдающими диету без изофлавонов, в то время как частота этих клеток была одинаковой у мышей на любой диете ( Рис.2, Б и В). Кроме того, потребление изофлавоновой диеты привело к более низкому абсолютному количеству, но не частоте, CD4 + Т-клеток из ЦНС, которые продуцируют IFN-γ, IL-17A и GM-CSF после стимуляции форбол 12-миристатом. 13-ацетат (PMA) и иономицин (рис.2, Г - Е). Вероятно, это связано с общим снижением инфильтрации иммунных клеток в ЦНС. Мыши на изофлавоновой диете продемонстрировали более низкое абсолютное количество клеточной инфильтрации CD45 + в ЦНС с соответствующим более низким количеством миелоидных клеток F4 / 80 + и тенденцией к снижению количества В-клеток CD19 + (рис. . S1, от A до E). Однако, несмотря на то, что между двумя группами наблюдалась разница в количестве клеток CD4 + , продуцирующих провоспалительные цитокины, в ЦНС, не было разницы в уровнях общего IFN-γ и IL-17A из гомогенатов ЦНС (рис.S1F). Это может быть результатом различных источников продукции цитокинов в ЦНС, поскольку эти цитокины могут действовать по-разному в зависимости от клеточного источника и ниши в ЦНС ( 26 ). Мы не обнаружили разницы в уровнях регуляторных Т-лимфоцитов CD4 + (T regs ) в ЦНС мышей, соблюдающих диету без изофлавонов или изофлавонов после EAE (рис. S1, G и H). Эти результаты предполагают, что потребление изофлавонов снижает инфильтрацию провоспалительных иммунных клеток в ЦНС после индукции EAE.

Рис. 2 Изофлавоновая диета снижает клеточную инфильтрацию CD4 + Т-клеток в ЦНС после EAE.

( A ) Схема экспериментального дизайна. Самок мышей в возрасте от четырех до шести недель помещали на указанную диету на 6 недель перед иммунизацией MOG 35-55 / CFA для индукции EAE. Мышей умерщвляли через 20 дней после иммунизации и собирали ЦНС для проточного цитометрического анализа инфильтрации лейкоцитов ЦНС. ( B ) Репрезентативные графики проточной цитометрии CD4 + и CD8 + Т-клеток (гейтированных на CD45 + CD19 - TCRβ + ) в ЦНС мышей, получавших изофлавоны или изофлавоны. диета после индукции EAE.Числа представляют частоту ячеек в указанных воротах. ( C ) Частота и абсолютное количество общих Т-клеток и CD4 + Т-клеток в ЦНС после индукции EAE, как в (B). Данные представляют три независимых эксперимента с пятью мышами в группе. ( D ) Типичный проточный цитометрический анализ CD4 + и CD8 + Т-клеток (селективных по CD45 + CD19 - TCRβ + клеток) в ЦНС мышей, получавших изофлавоны или не содержащие изофлавоны диета после индукции EAE и стимулированная PMA и иономицином в присутствии брефельдина A (BFA).( E ) Типичный проточный цитометрический анализ Т-клеток IL-17A + CD4 + , выделенных от мышей, как в (D), после стимуляции PMA и иономицином в присутствии (BFA). Числа представляют частоту ячеек в указанных воротах. Графики привязаны к живым CD45 + TCRβ + CD4 + Т-клеткам из (D). ( F ) Частота и абсолютное количество CD4 + IFN-γ + Т-клеток, CD4 + IL-17A + Т-клеток и CD4 + GMCSF + Т-клеток, выделенных из ЦНС мышей на (D) после стимуляции BFA (без стимуляции) или BFA и PMA / иономицином (стимуляция).Данные представляют два независимых эксперимента с пятью мышами в группе. Значение P определяли с помощью теста Стьюдента t . ** P <0,001; **** P <0,0001.

Изофлавоновая диета приводит к снижению активации и пролиферации MOG-специфических CD4

+ Т-клеток после индукции ЕАЕ

После индукции ЕАЕ миелиновыми пептидами антиген-специфические CD4 + Т-клетки активируются, пролиферируют и продуцируют провоспалительные цитокины на периферии перед миграцией в ЦНС.Чтобы определить, как изофлавоновая диета влияет на эту первичную стадию заболевания, мы поместили самок мышей C57BL / 6 на диету без изофлавонов или изофлавонов на 6 недель, индуцировали ЕАЕ с помощью MOG 35-55 / CFA и собрали дренирующую лимфу. узлов (dLN) до появления клинических симптомов (рис. 3A). Общее количество и частота CD4 + Т-клеток были неотличимы между двумя диетами (рис. 3B). Точно так же общее количество и частота Т-клеток CD4 + , продуцирующих IFN-γ- и IL-17A, не различались между двумя диетами, хотя наблюдалась тенденция к снижению частоты этих провоспалительных цитокинов, продуцирующих CD4 + . Т-клетки (рис.3, В и Г). В отличие от ЦНС, где большинство Т-клеток являются миелинспецифичными после индукции ЕАЕ, Т-клетки в dLN могут быть специфичными либо для миелиновых пептидов, либо для адъюванта ( Mycobacterium tuberculosis ), содержащегося в эмульсии иммунизации. Чтобы определить, влияет ли изофлавоновая диета на долю MOG 35-55 антиген-специфических CD4 + Т-клеток в dLN, мы использовали тетрамер MOG 35-55 в сочетании с маркером активации CD44 или маркером пролиферации. Ki67 ( 27 ).Иммунизированные мыши на диете изофлавонов имели пониженную частоту MOG 35-55 -специфических CD4 + Т-клеток, которые также были положительны по CD44 или Ki67, по сравнению с мышами на диете без изофлавонов, что позволяет предположить, что диета изофлавонов изменяет доля аутореактивных антиген-специфичных CD4 + Т-клеток (рис. 3, E и F). Чтобы определить, различалась ли ответная реакция на MOG 35-55 у мышей, получавших изофлавоновую и безизофлавоновую диету, мы провели тест стимуляции ex vivo с использованием клеток селезенки и dLN мышей, получавших изофлавоновую или безизофлавоновую диету. в течение 6 недель с последующей иммунизацией MOG 35-55 / CFA, как описано выше.Через семь дней после иммунизации клетки селезенки и dLN собирали и стимулировали MOG 35-55 в течение 3 дней с последующим анализом включения тимидина. Мы наблюдали, что клетки селезенки и dLN мышей на изофлавоновой диете размножались меньше, чем клетки мышей на диете без изофлавонов, что позволяет предположить, что изофлавоны способствуют созданию иммунологической среды, которая в меньшей степени способствует активации аутореактивных антиген-специфичных CD4 + Т-клеток (рис. 3G). Чтобы оценить, ограничивают ли CD4 + T regs аутоантиген-специфическое праймирование CD4 + Т-клеток у мышей с изофлавоновой диетой, мы измерили уровни CD4 + T regs в dLN через 7 дней после иммунизации.Однако мы не обнаружили разницы в частоте или абсолютном количестве CD4 + T regs (рис. S1, I и J).

Рис. 3 Изофлавоновая диета приводит к более низким уровням активированных MOG-специфических CD4 + Т-клеток в dLN и селезенке после EAE.

( A ) Схема экспериментального дизайна. Самок мышей в возрасте от четырех до шести недель помещали на указанную диету на 6 недель перед иммунизацией MOG 35-55 / CFA для индукции EAE.Через 7 дней мышей умерщвляли и собирали паховые лимфатические узлы для проточного цитометрического анализа. ( B ) Частота и абсолютное количество CD4 + Т-клеток (с гейтированием по CD45 + CD19 - TCRβ + ). ( C ) Репрезентативные графики проточной цитометрии CD4 + IFN-γ + T-клеток и CD4 + IL-17A + T-клеток, выделенных из dLN после стимуляции PMA и иономицином в присутствии BFA. Данные представляют три независимых эксперимента с пятью мышами в группе.( D ) Частота и абсолютное количество CD4 + IFN-γ + Т-клеток и CD4 + IL-17 + Т-клеток, как в (C). ( E ) Репрезентативные графики проточной цитометрии CD4 + MOG 35-55 тетрамер + CD44 + Т-клетки и CD4 + MOG 35-55 тетрамер + Ki клетки из пахового лимфатического узла. Клетки были заблокированы на живых TCRβ + CD4 + Т-клетках.Данные представляют три независимых эксперимента с пятью мышами в группе. ( F ) Частота и абсолютное количество CD4 + MOG 35-55 тетрамер + CD44 + Т-клетки и CD4 + MOG 35-55 тетрамер + Ki67 + T ячейки, как в (E). Значение P определяли с помощью теста Стьюдента t . ( G ) Пролиферация CD4 + Т-клеток, выделенных из селезенки и паховых лимфатических узлов мышей, получавших диету без изофлавонов или изофлавонов.Мышей иммунизировали, как в (A), и перед началом заболевания клетки собирали, высевали и стимулировали MOG 35-55 с последующим анализом включения тимидина. Данные представляют три независимых эксперимента с пятью мышами в группе. Значение P определяли двухфакторным дисперсионным анализом. * P <0,05; ** P <0,001; *** P <0,001.

Состав микробиома кишечника отличается у мышей, получавших изофлавоновую диету, и тех, кто получал диету без изофлавонов.

На данный момент наши данные показывают, что изофлавоновая диета связана со снижением антиген-специфических воспалительных реакций и может подавлять ЕАЕ.Молекулярный состав диеты представляет собой главный фактор в определении состава микробиоты кишечника, который может влиять на ответы иммунных клеток ( 28 ). Поэтому мы предположили, что один из механизмов, с помощью которого изофлавоны влияют на функцию Т-клеток и подавляют болезнь, заключается в изменении состава микробиома кишечника. Чтобы решить эту проблему, мы поместили самок мышей C57BL / 6J либо на диету, либо на диету без изофлавонов в течение 6 недель, после чего мы выполнили метагеномное секвенирование 16 S рибосомной РНК (рРНК) (V3-V4) бактериальной ДНК, выделенной из кал (рис.4А) ( 29 ). Индекс Чао - это непараметрический метод оценки количества видов в сообществе. Используя этот метод, мы обнаружили, что разнообразие бактерий в пределах отдельного хозяина (т.е. альфа-разнообразие) было уменьшено у мышей на диете без изофлавонов по сравнению с мышами на диете изофлавонов (рис. 4B, слева). Это говорит о том, что изофлавоновая диета увеличивает видовое богатство микробиома, что связано со снижением воспаления и общим улучшением здоровья ( 30 ).Анализ бета-разнообразия, который сравнивает относительную численность бактерий между двумя или более группами, продемонстрировал, что микробиомы кишечника различны между мышами, соблюдающими изофлавоновую диету, и мышами, соблюдающими диету без изофлавонов (рис. 4B, справа). Примечательно, что конкретные различия в родах бактерий между мышами на двух диетах коррелировали с некоторыми бактериальными различиями, наблюдаемыми между пациентами с РС и здоровыми людьми в контрольной группе ( 9 , 14 , 16 , 17 ). В частности, Adlercreutzia и Parabacteroides distasonis , которые метаболизируют изофлавоны, были более распространены у мышей на изофлавоновой диете (рис.4С). Мы также подтвердили идентичность этих бактерий с помощью количественной полимеразной цепной реакции (КПЦР) с использованием видоспецифичных праймеров в образцах фекалий этих мышей (рис. 4D). Примечательно, что оба рода были обогащены у здоровых людей, но истощены у пациентов с РС ( 8 ). Напротив, Akkermansia muciniphila было обнаружено в большем количестве у мышей, соблюдающих диету без изофлавонов, и этот род обычно более богат у пациентов с РС по сравнению со здоровыми людьми (рис.4С) ( 8 ). Более подробный анализ дифференциальной таксономической распространенности изофлавонов и мышей без изофлавонов доступен в дополнительных материалах (таблица S2). Учитывая, что мыши, соблюдающие изофлавоновую диету, могут подавлять ЕАЭ, эти данные свидетельствуют о том, что изофлавоновая диета способствует размножению определенных кишечных бактерий, которые могут улучшить исход заболевания при ЕАЕ и, возможно, РС.

Рис. 4 Диета без изофлавонов и изофлавонов изменяет микробиом кишечника.

( A ) Схема экспериментального дизайна. Самок мышей в возрасте от четырех до шести недель помещали на указанную диету на 6 недель с последующим сбором фекалий, выделением бактериальной ДНК и анализом секвенирования 16 S . ( B ) Графики индекса Chao ( t тест, P = 0,023655) и PCoA (пермутационный дисперсионный анализ ANOVA, P <0,001) для мышей на диете, не содержащей изофлавонов или изофлавонов. Каждая точка представляет одну мышь. Без изофлавонов, n = 10 мышей, две клетки.Изофлавон, n = 13 мышей, три клетки. Значения взяты из одного независимого репрезентативного эксперимента ( C ). Значения численности P. distasonis ( t тест, P = 8,8102 × 10 −4 ; FDR (коэффициент ложного обнаружения) = 0,0039646), Adlercreutzia ( t тест, P = 0,014204; FDR = 0,041794) и A. muciniphila ( t тест, P = 2,846 × 10 -4 ; FDR = 0,0025614), как определено анализом секвенирования в (B), у мышей на изофлавоне или диета без изофлавонов.( D ) Уровни Adlercreutzia equolifaciens и P. distasonis в образцах фекалий, измеренные с помощью кПЦР с использованием видоспецифичных праймеров, у мышей после 6 недель на указанной диете. Значение P определяли с использованием теста Стьюдента t ; **** P <0,0001. Более высокие значения CT указывают на более низкие уровни ДНК, тогда как более низкие значения CT указывают на более высокие уровни ДНК.

Бактерии, метаболизирующие изофлавоны, и их метаболиты необходимы для подавления ЕАЕ у мышей, получавших изофлавоновую диету.

Кишечные бактерии метаболизируют пищевые компоненты, что приводит к выработке метаболитов, которые вносят вклад в существенную биологическую активность организма-хозяина.Однако неясно, требуются ли определенные бактерии, такие как P. distasonis и A. equolifaciens для положительных эффектов, наблюдаемых у мышей, получавших изофлавоновую диету. Поэтому, чтобы определить важность метаболизма кишечных бактерий в защите от изофлавон-ассоциированного ЕАЭ, мы оценили ответы на индукцию ЕАЕ у мышей, кишечная микробиота которых была устранена и восстановлена ​​определенными родами (рис. 5А). Самок мышей C57BL / 6J помещали на диету либо изофлавонов, либо без изофлавонов и лечили антибиотиком широкого спектра действия, доставляемым с питьевой водой, для устранения микробиоты кишечника ( 31 , 32 ).Затем мышей на обоих диетах вводили перорально культурами P. distasonis и A. equolifaciens в течение 2 недель с последующей индукцией EAE. Мы обнаружили, что у мышей, получавших изофлавоновую диету, P. distasonis и A. equolifaciens имели решающее значение для защиты от EAE [Рис. 5, B (вверху слева) и C], тогда как у мышей на любой диете, получавшей только среду, защиты не было (фиг. 5B, вверху справа). Напротив, присутствие этих бактерий обостряло заболевание у мышей, получавших диету без изофлавонов (рис.5B, вверху слева). Мы видели, что группа Iso + Media имела тенденцию к более высоким клиническим показателям ЕАЕ, чем группа Iso + P. dis + A. equ ( P = 0,063), и статистически значимая разница в площади под кривой (AUC ) наблюдалась между этими двумя группами, что представляет собой совокупный анализ EAE (рис. 5C). Кроме того, мы подтвердили успешное восстановление P. distasonis и A. equolifaciens с помощью кПЦР с использованием видоспецифичных праймеров в образцах фекалий этих мышей (рис.5D). Чтобы подтвердить, что бактерии, метаболизирующие изофлавоны, особенно необходимы для этого явления, мы провели тот же эксперимент, воссоздав бактерию, не метаболизирующую изофлавоны, Escherichia coli ( 33 ). Мы обнаружили, что не было различий в EAE между мышами на любой диете, которые получали E. coli (рис. 5B, внизу слева). Это говорит о том, что бактерии, метаболизирующие изофлавоны, могут уникальным образом защищать от EAE, когда хозяин находится на изофлавоновой диете.Учитывая, что A. muciniphila было увеличено в микробиоме кишечника мышей на диете без изофлавонов, мы попытались выяснить, как эта бактерия влияет на EAE в нашей модели. Поэтому мы выполнили тот же эксперимент, что и выше, но с восстановлением с использованием A. muciniphila и наблюдали, что мыши на безизофлавоновой диете, которые получали A. muciniphila , демонстрировали немного худший EAE, чем мыши, получавшие изофлавоновую диету, получавшие те же бактерии (рис. 5B). , Нижний правый). Это говорит о том, что А.muciniphila может отрицательно влиять на EAE у мышей, соблюдающих диету без изофлавонов.

Рис. 5 Защитная способность изофлавоновой диеты зависит от присутствия бактерий, метаболизирующих изофлавоны, и их метаболитов.

( A ) Схема экспериментального дизайна. Самок мышей в возрасте от четырех до шести недель помещали на изофлавоновую диету или диету без изофлавонов на 4 недели, одновременно получая антибиотики широкого спектра действия с питьевой водой. Впоследствии мыши поддерживали соответствующую диету и получали либо A.equolifaciens и P. distasonis , среда для роста бактерий, A. muciniphila или E. coli через день в течение 2 недель с последующей иммунизацией MOG 35-55 / CFA для индукции EAE. ( B ) Клинические оценки EAE для мышей, получавших A. equolifaciens и P. distasonis (вверху слева), бактериальную среду для роста (вверху справа), E. coli (внизу слева) или A. muciniphila (внизу справа). Данные представляют три независимых эксперимента с пятью мышами в группе.нс, не имеет значения. ( C ) Анализ AUC для изофлавон + среда и изофлавон + P. distasonis + A. equolifaciens групп. ( D ) Уровни A. equolifaciens и P. distasonis в образцах фекалий, измеренные с помощью кПЦР с использованием видоспецифичных праймеров, у мышей на указанной диете после 2 недель обработки теми же бактериями через желудочный зонд. как в (А). ( E ) Схема экспериментального дизайна. Самок мышей в возрасте от четырех до шести недель помещали либо на изофлавоновую диету, либо на диету без изофлавонов в течение 4 недель.Мыши придерживались соответствующей диеты и получали перорально контрольный носитель либо эквол, либо ДМСО (оба ресуспендировали в минеральном масле) каждый день с последующей иммунизацией MOG 35-55 / CFA для индукции EAE. Обработка Equol и DMSO проводилась на протяжении всего эксперимента. ( F ) Клинические показатели EAE для мышей, получавших эквол (слева) или ДМСО (справа). Данные представляют собой два объединенных эксперимента с пятью мышами в группе. ( G ) Анализ AUC для без изофлавонов + ДМСО и без изофлавонов + эквол.Тесты с двумя группами сравнивали с использованием теста Стьюдента t . P Значения определяли с помощью двухфакторного дисперсионного анализа оценок EAE. * P <0,05; *** P <0,001; **** P <0,0001.

Трансплантация фекальной микробиоты (FMT) - это терапия на основе кишечного микробиома, которая в настоящее время проверяется на эффективность при лечении различных иммуноопосредованных заболеваний ( 34 ). Чтобы определить, влияет ли FMT от изофлавоновых мышей или мышей без изофлавонов на EAE, мы обрабатывали нормальных реципиентов корма гомогенизированными фекалиями от доноров, не содержащих изофлавоны или не содержащих изофлавонов (рис.S2A). Мы обнаружили, что не было никакой разницы в клиническом заболевании EAE между нормальными реципиентами корма, которые получали FMT изофлавонов или FMT без изофлавонов (рис. S2B). Поскольку нормальный корм для мышей имеет умеренные уровни изофлавонов, нормальные реципиенты корма могли выбрать бактерии, метаболизирующие изофлавоны, что привело к неотличимому клиническому заболеванию EAE. Чтобы определить, влияет ли диета реципиента на FMT, мы провели аналогичный эксперимент, но с реципиентами без изофлавона и без изофлавона (рис.S2C). Мы обнаружили, что, хотя это и не является статистически значимым, две группы реципиентов без изофлавонов имели более высокие клинические баллы EAE, чем две группы реципиентов изофлавонов (рис. S2D). Это говорит о том, что диета реципиента влияет на терапевтическую ценность FMT. В целом, эти эксперименты показывают, что у мышей кишечные бактерии, метаболизирующие изофлавоны, имеют решающее значение для опосредованной изофлавоновой диетой защиты от EAE.

Изофлавоны расщепляются родами Parabacteroides и Adlercreutzia на биологически активные метаболиты, такие как S-эквол, повышая их активность ( 35 ).Поэтому мы стремились определить, может ли лечение мышей одним S-экволом улучшить ЕАЕ. Для этого мы поместили самок мышей C57BL / 6J на диету без изофлавонов или изофлавонов с последующим немедленным введением (50 мг / кг) S-эквола или минерального масла в течение 4 недель и последующей индукцией EAE (рис. 5E). Мыши получали ежедневное лечение S-экволом в течение всего эксперимента. Примечательно, что мы обнаружили, что лечение мышей на диете без изофлавонов с помощью S-эквола улучшало ЕАЕ, при этом тяжесть заболевания была аналогична таковой у мышей на диете изофлавонов (рис.5F). Кроме того, мы увидели значительную разницу в сравнении клинических показателей ЕАЕ между изо-свободным + ДМСО (диметилсульфоксид) и изо-свободным + Equol ( P <0,001) и статистически значимой разницей в AUC между этими двумя группами, которая представляет собой совокупный анализ EAE (рис. 5G). Таким образом, эти результаты предполагают, что S-эквол способствует защите от болезней, обеспечиваемой изофлавоновой диетой.

Индуцированные кишечными микробами изменения кишечного иммунитета или функции кишечного барьера могут быть связаны с изменениями заболевания в дистальных участках органов (т.е., ЦНС) ( 8 ). Чтобы определить, как изофлавоновая диета влияет на иммунитет кишечника, мы проанализировали иммунный профиль в собственной пластинке толстой кишки самок мышей C57BL / 6J на диете без изофлавонов и изофлавонов (рис. S3A). Мы наблюдали незначительные изменения в представлении определенных популяций DC и потенциально значимое увеличение частоты и количества Т-клеток CD8 + у мышей с изофлавоновой диетой; однако никаких изменений ни в частоте, ни в количестве CD4 + Т-клеток или В-клеток не наблюдалось (рис.S3, от B до I). Чтобы определить, влияет ли какая-либо диета на функцию кишечного барьера, мы провели анализ кишечной проницаемости флуоресцеина изотиоцианат (FITC) –декстран (рис. S4A). Мы обнаружили, что у мышей на диете без изофлавонов наблюдается повышенная кишечная проницаемость по сравнению с мышами на изофлавоновой диете через 2 часа после лечения FITC-декстраном (рис. S4B). Принимая во внимание, что иммунные клетки в кишечнике, как было показано, участвуют в внекишечных заболеваниях, эти эксперименты предполагают, что изменения в кишечной ткани могут быть связаны с способностью изофлавоновой диеты защищать от EAE.

ОБСУЖДЕНИЕ

Кишечник человека обеспечивает идеальную анаэробную среду для размножения бактерий, и, следовательно, кишечные бактерии стали критически важными для иммунитета слизистой оболочки, целостности барьера и доступности питательных веществ, среди других процессов, важных для гомеостаза хозяина ( 8 ). Несмотря на то, что микробиом кишечника связан с РС, механизм, с помощью которого кишечные бактерии предрасполагают людей к РС или обеспечивают защиту от него, неизвестен. Здесь мы демонстрируем, что изофлавоновая диета обеспечивает защиту от EAE, животной модели рассеянного склероза, что связано с уменьшением как тяжести патологии спинного мозга, так и количества воспалительных клеток в ЦНС.Наши данные показывают, что это явление, вероятно, связано с недостаточным праймированием на периферии после индукции заболевания. Кроме того, микробиом кишечника мышей, получавших изофлавоновую диету, обладает противовоспалительными характеристиками, которые сопоставимы со здоровым микробиомом кишечника человека. Защита от болезней и противовоспалительный фенотип, связанный с изофлавоновой диетой, который мы наблюдали, основывались на присутствии определенных бактерий, которые могут метаболизировать изофлавон в S-эквол, демонстрируя, что кишечные бактерии, метаболизирующие изофлавоны, которые генерируют метаболиты изофлавона, обеспечивают защиту от EAE.В совокупности эти результаты предполагают, что метаболиты некоторых кишечных бактерий могут изменять аутоиммунитет ЦНС.

Обнаружение того, что диета с изофлавонами защищает от ЭАЭ по сравнению с диетой без изофлавонов, убедительно подтверждает идею о том, что факторы окружающей среды влияют на исход болезни. Хотя ранее сообщалось о терапевтическом потенциале фитоэстрогенных соединений при EAE, в большинстве исследований фитоэстрогены вводились нефизиологическим путем (подкожно или внутрибрюшинно) ( 36 ).Хотя сообщалось, что пероральное лечение фитоэстрогенами снижает ЭАЭ, наше исследование демонстрирует решающую роль в этом процессе кишечных бактерий, метаболизирующих фитоэстроген ( 37 ). Наша диетическая модель учитывает взаимодействие между диетой, кишечной микробиотой и иммунной системой, тем самым отражая физиологически релевантный путь / пути, посредством которых изофлавоны могут защищать или облегчать заболевание у пациентов с РС ( 36 ). Изофлавоны представляют собой основной компонент рациона человека, особенно в азиатских странах, где обычно редко наблюдаются рассеянный склероз и аутоиммунитет ( 38 ).Хотя мало что известно о вкладе изофлавоновой диеты в патогенез РС, некоторые исследования связывают потребление сои и других бобовых со снижением риска РС или клинически изолированного синдрома (CIS) ( 39 , 40 ). Однако по мере того, как азиатские культуры придерживаются более западного стиля диеты (т.е. с высокой степенью переработки, высоким содержанием жиров, чрезмерным количеством мяса и молочных продуктов и низким содержанием клетчатки), в них наблюдается рост заболеваемости РС ( 41 ). Способность производить эквол различается у разных людей, особенно у людей из разных географических регионов.Частота так называемых «производителей экволов» значительно выше в азиатских странах и среди вегетарианцев, чем в западных странах и среди невегетарианцев ( 42 , 43 ). Это говорит о том, что диета оказывает сильное влияние на способность человека вырабатывать эквол. Однако не каждый, кто потребляет сою, может производить эквол, вероятно, из-за отсутствия бактерий, метаболизирующих изофлавоны, в кишечнике этих так называемых «продуцентов неэкволов» ( 44 ). Это говорит о том, что множество факторов, помимо диеты, способствуют колонизации бактерий, метаболизирующих изофлавоны.Было бы интересно определить, задерживается ли у пациентов с РС способность производить эквол и / или колонизироваться бактериями, метаболизирующими изофлавоны. В совокупности эти результаты предполагают, что потребление изофлавонов коррелирует со снижением аутоиммунитета ЦНС.

Приведенные выше данные свидетельствуют о том, что потребление питательных веществ и общее качество диеты могут влиять на патогенез и симптоматику рассеянного склероза. Следовательно, большинство пациентов с рассеянным склерозом заинтересованы в диетическом режиме, чтобы обуздать симптомы, или внедрили его, основываясь на неофициальных данных и рекомендациях сообщества пациентов с рассеянным склерозом и / или их поставщика медицинских услуг.Пациентам с РС рекомендовано несколько диет, в том числе кетогенная диета, прерывистое голодание, средиземноморская диета, безглютеновая диета, диета Суонка и диета Уолса ( 45 , 46 ). Согласно многочисленным клиническим испытаниям, эпидемиологическим и наблюдательным исследованиям, эффективность этих диет в отношении уменьшения симптомов и воспалительных маркеров различна; некоторые исследования демонстрируют клинически значимые улучшения, в то время как другие исследования с соблюдением той же диеты не демонстрируют значительных изменений ( 47 ).Таким образом, хотя общее состояние здоровья явно зависит от качества питания, нет никаких доказательств того, что конкретный режим питания эффективен для снижения заболеваемости РС из-за различных результатов клинических исследований. Результаты нашего исследования подчеркивают идею о том, что состав микробиома кишечника пациента, вероятно, является критической переменной в эффективности диетических вмешательств, что часто упускается из виду в предыдущих исследованиях и клинических испытаниях.

На людях несколько исследований продемонстрировали, что пациенты с РС демонстрируют отличную кишечную микробиоту по сравнению со здоровыми людьми ( 8 ).Хотя не существует конкретной «сигнатуры кишечного микробиома РС», некоторые роды и виды бактерий обычно либо обогащены, либо истощены у пациентов с РС. Например, P. distasonis и A. equolifaciens , бактерии, метаболизирующие изофлавоны, уменьшаются у пациентов с РС из географически разных групп ( 9 , 16 ). P. distasonis при переносе мышам индуцирует фенотип T reg в селезенке и мезентериальных лимфатических узлах ( 16 ).Кроме того, у стерильных мышей, которым трансплантировали образцы фекалий от здоровых доноров, было более высокое содержание Adlercreutzia , чем у мышей с трансплантированными фекалиями MS ( 17 ). Кроме того, у здоровых донорских мышей с трансплантированными фекалиями частота спонтанного EAE была ниже, чем у мышей, которым трансплантировали образцы фекалий MS ( 17 ). Мы обнаружили, что у мышей на изофлавоновой диете наблюдалось увеличение численности P. distasonis и A. equolifaciens , подтверждая предыдущие сообщения о том, что диета оказывает огромное влияние на состав микробиоты кишечника ( 28 ).В нашем исследовании мы демонстрируем, что бактериальная терапия с использованием P. distasonis и A. equolifaciens приводит к заметно разным клиническим показателям заболевания в зависимости от диеты хозяина. В отсутствие изофлавонов эти бактерии, метаболизирующие изофлавоны, могут начать метаболизировать продукты хозяина, такие как муцины, что приводит к провоспалительному состоянию. Напротив, наши результаты, показывающие, что лечение экволом облегчает течение болезни, независимо от диеты, убедительно свидетельствуют о том, что метаболиты, которые образуются из кишечных бактерий в результате расщепления пищевых соединений, влияют на течение заболевания.Эти открытия имеют далеко идущие применения, а именно, что учет взаимодействия между диетой и кишечными бактериями имеет решающее значение при разработке методов лечения РС и других заболеваний на основе диеты и микробиома кишечника. Специфические бактериологические методы лечения или лечение метаболитами, продуцируемыми кишечными бактериями, улучшают или обостряют заболевание, и наше исследование расширяет эти результаты, чтобы продемонстрировать тонкое взаимодействие между диетой, кишечными бактериями и метаболитами, продуцируемыми кишечными бактериями, а также влияние этой триады на заболевание.По мере того, как область становится все более осведомленной об этой связи, клинические испытания переходят на оценку как диеты, так и микробиома кишечника, поскольку они связаны с результатами лечения пациентов.

Наше исследование демонстрирует, что употребление изофлавоновой диеты подавляет заболевание EAE через микробный метаболизм кишечника; однако клеточные и молекулярные пути, с помощью которых кишечные бактерии подавляют болезнь, неизвестны. В частности, у мышей на изофлавоновой диете наблюдается более низкая частота активированных миелин-специфических CD4 + Т-клеток после индукции заболевания, однако неясно, как генерируемый бактериями эквол или другие метаболиты ослабляют активность иммунных клеток.Фитоэстрогены могут влиять на широкий спектр процессов, включая кишечные и системные иммунные ответы ( 36 ). Поскольку эквол, побочный продукт метаболизма изофлавонов, является эстрогенным, предполагается, что изофлавоны действуют через рецепторы эстрогена, особенно ERβ ( 36 ). Это соответствовало бы устоявшейся идее о том, что эстроген защищает от EAE и MS ( 48 ). Необходимы дальнейшие исследования по определению клеток, ответственных за эквол-зависимое подавление болезней.Кроме того, неизвестно, передает ли эквол сигнал через ось кишечник-мозг, двунаправленную связь между ЦНС и кишечной нервной системой или через системные эффекты, напрямую влияя на иммунную систему.

Учитывая, что в микробиоме кишечника имеется> 3 000 000 генов по сравнению с 20 000-25 000 генов, кодирующих белок во всем геноме человека, ожидается, что микробиота кишечника играет фундаментальную роль в здоровье кишечника и системы ( 49 ). Наши данные демонстрируют, что диета является фактором окружающей среды, который может изменить состав микробиоты кишечника и что это имеет последствия для исхода болезни.Это закладывает основу для будущих исследований клеточных и молекулярных путей, ответственных за супрессию ЭАЭ, вызванную экволом. В конечном счете, эти исследования позволят нам использовать методы лечения на основе диеты и микробиома кишечника в качестве дополнения к обычным модифицирующим заболевания методам лечения (IFN-β, глатирамера ацетат, финголимод, окрелизумаб и т. Д.) Для лечения рассеянного склероза и других заболеваний.

МАТЕРИАЛЫ И МЕТОДЫ

Мыши, диетическое лечение, индукция заболевания EAE и оценка

Самок мышей C57BL / 6J (возраст от 4 до 6 недель) и мышей SJL / J (возраст от 4 до 6 недель) были приобретены у Jackson Лаборатории (Бар-Харбор, Мэн).Трансгенные самки мышей HLA-DR15 ( DRA1 * 0101; DB1 * 1501 ) на фоне дефицита MHC II (AE °) (называемые здесь мыши AE ° DR2) были щедро предоставлены C. David ( 50 ). Мышей помещали либо на изофлавоновую диету [генистеин (0,24 г / кг рациона) и даидзеин (0,22 г / кг рациона)], либо на диету без изофлавонов (Envigo, Indianapolis, IN) ad libitum в течение 6 недель. Обычный корм - это стандартный корм для мышей, доступный в животноводческих помещениях Университета Айовы (Envigo 7013).В исследованиях ЕАЭ индуцировали и оценивали ЕАЭ, как показано ранее ( 51 ). Вкратце, мышей иммунизировали подкожно в день 0 на левом и правом фланге 100 мкг MOG 35-55 (для C57BL / 6J и DR2) или 50 мкг эмульгированного PLP 139-151 (для SJL / J). в 200 мкг CFA с последующим введением 80 нг токсина коклюша (PTX) внутрибрюшинно в дни 0 и 2 (только мыши C57BL / 6 и DR2 получали PTX). Степень тяжести заболевания оценивалась следующим образом: 0 - отсутствие клинических симптомов; 1 - потеря тонуса хвоста; 2 - слабость задних конечностей; 3 - паралич задних конечностей; 4 - слабость передних конечностей; и 5, умирание или смерть.Все процедуры были выполнены в соответствии с руководящими принципами Институционального комитета по уходу за животными и их использованию в Университете Айовы.

Гистология

Мышей умерщвляли с использованием CO 2 и внутрисосудисто перфузировали с использованием системы гравитационного питания с 10% нейтральным забуференным формалином (10% NBF) посредством внутрисердечной пункции ( 52 ). Затем спинной мозг фиксировали всплыванием в 10% NBF еще на 24-48 часов. Спинной мозг оставляли на месте, деминерализовали 14% EDTA в течение ~ 4 дней, а затем заливали парафином и обрабатывали в обычном порядке.Срезы (толщиной 4 мкм) были окрашены гематоксилином и эозином и проанализированы сертифицированным ветеринарным патологом. Срезы спинного мозга оценивали на предмет патологии спинного мозга и воспаления мозговых оболочек. Оценка менингеального воспаления по шкале от 0 до 4, где 0 - отсутствие патологии; 1 - редкие, рассеянные и легкие инфильтраты воспалительных клеток менингеальных оболочек; 2 - мягкие мультифокальные и очевидные инфильтраты воспалительных клеток менингеальных клеток; 3, мультифокальный к сливающимся инфильтратам воспалительных клеток менингеальных клеток; и 4 - заметные, диффузные и толстые полосы инфильтратов воспалительных клеток менингеальной оболочки.Оценка спинного мозга определяет, какая часть спинного мозга на этом уровне была поражена, а также шкала от 0 до 4, где 0 - отсутствие патологии; 1, от 1 до 25% спинного мозга поражены патологией, соответствующей EAE; 2, от 30 до 50% спинного мозга поражены патологией, соответствующей EAE; 3, от 60 до 90% спинного мозга поражены патологией, соответствующей EAE; и 4,> 90% спинного мозга поражены патологией, соответствующей EAE.

Выделение клеток

Если указано, селезенки и паховые лимфатические узлы собирали, гомогенизировали и помещали в одноклеточную суспензию для дальнейшего использования.Периферическую кровь собирали с помощью ретроорбитального кровотечения и помещали в одноклеточную суспензию для дальнейшего использования. Для выделения лейкоцитов ЦНС мышей анестезировали CO 2 и быстро перфузировали через левый желудочек холодным физиологическим раствором с фосфатным буфером (PBS). Головной мозг удаляли из черепа, и спинной мозг промывали через позвоночный канал холодной средой RPMI. Для выделения иммунных клеток из ЦНС мозг и спинной мозг объединяли, гомогенизировали и выделяли центрифугированием в градиенте Перколла ( 52 ).После центрифугирования лейкоциты ЦНС были собраны с поверхности раздела, промыты и подготовлены соответствующим образом для дальнейшего использования. Для выделения иммунных клеток из собственной пластинки толстой кишки толстые кишки собирали и переваривали в буфере коллагеназа / дезоксирибонуклеаза, как описано ранее ( 53 ).

Анализ кишечной проницаемости

Для измерения кишечной проницаемости мышей перорально вводили декстран, меченный FITC, 4 кДа. Флуоресценцию сыворотки измеряли в последующие моменты времени и сравнивали с сывороткой, вводимой через желудочный зонд ( 54 ).

Анализ включения тимидина

Для измерения пролиферации в паховых лимфатических узлах клетки с 7-го дня после иммунизации мышей EAE заражали средой, нерелевантным пептидом OVA 257-264 , MOG 35-55 или конканавалином A ex vivo, как описано ранее ( 55 ). Результаты представлены в виде количества включений тимидина в минуту.

Проточная цитометрия

Данные проточной цитометрии были получены на BD FACSCanto II или BD LSR II и проанализированы с помощью программного обеспечения FlowJo (Ashland, OR).Для определения экспрессии поверхностных маркеров суспензии отдельных клеток инкубировали с моноклональными антителами (mAb) при 4 ° C в течение 30 мин с последующей фиксацией. Для внутриклеточного окрашивания цитокинов / факторов транскрипции клетки окрашивали на поверхностные маркеры, фиксировали, пермеабилизировали с использованием набора буферов для окрашивания FoxP3 / факторов транскрипции (eBioscience, Сан-Диего, Калифорния) и инкубировали с mAb при 4 ° C в течение 30 мин. В качестве моноклональных антител использовали CD45 (30-F11, BD Biosciences), Т-клеточный рецептор β (TCRβ) (H57-597, eBioscience), CD19 (6D5, BD Biosciences), CD4 (RM4-5, BD Biosciences), CD8 (53 -6.7, BD Biosciences), IL-17A (TC11-18h20, eBioscience), IFN-γ (XMG1.2, eBioscience), GMCSF (колониестимулирующий фактор гранулоцитов-макрофагов) (MP1-22E9, eBioscience), CD44 (IM7, BD Biosciences), Ki67 (B56, BD Biosciences), F4 / 80 (BM8, eBioscience), FoxP3 (FJK-16s, eBioscience), CD25 (PC61, BD Biosciences), CD11c (N418, BioLegend), IA / IE (M5 /114.15.2, BD Biosciences), тетрамер MOG [MOG 38-49 GWYRSPFSRVVH, центр тетрамера Национального института здоровья (NIH), Атланта, Джорджия] и Zombie Aqua (BioLegend).

Стимуляция PMA

Лейкоциты из ЦНС, селезенки или пахового лимфатического узла инкубировали при 37 ° C с коктейлем для стимуляции клеток (Thermo Fisher Scientific, Waltham, MA) или коктейлем из ингибиторов транспорта белка (Thermo Fisher Scientific, Waltham, MA) на 6 часов. Клетки окрашивали на CD45, CD4, IFN-γ, IL-17A и GMCSF.

Сбор кала и анализ микробиома

Анализ микробиома проводили, как описано ранее ( 29 ). Вкратце, фекальные гранулы собирали у отдельных мышей из каждой группы и хранили при -80 ° C до анализа.Чтобы уменьшить эффект клетки, образцы фекалий собирали у мышей в двух-трех клетках на каждую группу, по три-пять мышей в каждой клетке. ДНК экстрагировали с использованием набора DNeasy PowerLyzer PowerSoil (Qiagen). 16 S область рРНК V3-V4 амплифицировали с использованием праймеров для ПЦР (прямой 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGNGGCWGCAG-3 '; обратный 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACGCCGACT-индекс 9 (900) с использованием набора XI-900 с использованием набора XNUMXX-9 и XNUMX-9) Очищенные продукты ПЦР секвенировали с использованием Illumina MiSeq.

Для обрезки, объединения и фильтрации считываний использовалась платформа Divisive Amplicon Denoising Algorithm 2 на основе R ( 56 ). Данные были сопоставлены со справочной базой данных Greengenes для присвоения обозначений таксонов. Платформа Microbiome Analyst использовалась для статистического анализа и построения цифр. Данные были отфильтрованы, чтобы удалить особенности с низким счетом и низкой дисперсией, которые, вероятно, присутствовали из-за загрязнения или ошибки. Нормализация проводилась путем масштабирования общей суммы. Отфильтрованные данные использовались для определения бета-разнообразия и дифференциальной численности.График бета-разнообразия был создан с использованием анализа основных координат (PCoA) с перестановочным многомерным анализом дисперсионного теста для оценки значимости. Дифференциальная численность оценивалась с помощью MetagenomeSeq, статистического метода, который сочетает в себе нормализацию кумулятивной суммы масштабирования и гауссово распределение с нулевым раздутием для сравнения наборов данных с учетом недостаточной выборки в данных с высокой пропускной способностью ( 57 ). Анализ альфа-разнообразия проводился на нефильтрованных данных.

Истощение кишечной флоры, колонизация бактериями, FMT и обработка экволом

Для истощения кишечной флоры мышей помещали в стерильную воду с добавлением ванкомицина (0.5 г / литр), неомицин (1 г / литр), метронидазол (1 г / литр), ампициллин (1 г / литр) и Splenda (четыре пакета / литр) в течение 4 недель с последующим 2-дневным лечением стерильных вода до обработки бактериями ( 31 , 32 ). P. distasonis ATCC (Американская коллекция типовых культур) 8503 и Adlercreutzia equolifaciens DSM 19450 [DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH)] были заказаны из соответствующих источников и культивированы в соответствии с предоставленными инструкциями. E. coli была щедро предоставлена ​​Р. Пателем из клиники Майо и культивировалась аналогично P. distasonis и A. equolifaciens . A. muciniphila была щедро предоставлена ​​П. Кумаром из Университета Стоуни-Брук и культивировалась в анаэробных условиях при 37 ° C с использованием агара для инфузии сердца мозга (BHI) + 0,4% муцина или бульона BHI + 0,4% муцина + l-цистеина. По показаниям мышей обрабатывали 10 8 бактериальных КОЕ (колониеобразующих единиц) через день в течение 2 недель.Для экспериментов FMT мышей-доноров помещали в стерильную клетку и отбирали пробы фекалий в асептических условиях. Фекалии гомогенизировали на сетчатом фильтре 100 мкм для удаления крупных частиц и разбавляли 0,1% цистеином в PBS в концентрации 1 г фекалий / 10 мл 0,1% цистеина в PBS. Каждая мышь-реципиент получала 150 мкл фекального препарата. Свежие образцы фекалий доноров собирали и обрабатывали, как описано, через день в течение 2 недель до индукции EAE. Для экспериментов по лечению экволом мышей перорально вводили эквол (50 мг / кг), ресуспендированный в ДМСО, каждый день в течение всего эксперимента.Затем исходные смеси Equol / DMSO разбавляли минеральным маслом до указанной концентрации.

Количественная полимеразная цепная реакция

Для количественного определения бактериальной ДНК в кале ДНК выделяли и количественно определяли, как описано ранее ( 29 ). Уровни генов определяли с помощью количественной ПЦР с использованием реагентов Power Sybr Green (Applied Biosystems) и системы ПЦР в реальном времени QuantStudio 3. Реакции КПЦР проводили на 100 нг бактериальной ДНК на образец. Использовали следующие наборы праймеров: P.distasonis (прямой 5 'AGGGAATAAAGTGCGGGACG 3'; обратный 5 'CTTTCG TGCATCAGCGTCAG 3') и A. equolifaciens (прямой 5 'GGCGTGCTTAACACATGCAA 3'; обратный 5 'TTGCGCAAAATTCCACTCCACT).

Статистика

Группы ЕАЕ сравнивали с использованием двухфакторного дисперсионного анализа (ANOVA). Тесты с двумя группами сравнивали с помощью теста Стьюдента t . Все статистические данные были рассчитаны с использованием программного обеспечения GraphPad Prism (La Jolla, CA). P <0,05 считалось значимым.

ССЫЛКИ И УКАЗАНИЯ

  1. 9095 9095 9095 9095 9095 9095 9095 9095
  2. DA Schreihofer, Нейрозащита диетическими изофлавонами и их роль в церебральной ишемии, в Биоактивных нутрицевтиков и диетических добавок при неврологических заболеваниях и болезнях головного мозга , R.Р. Уотсон, В. Р. Приди, Eds. (Elsevier, 2015), стр. 385–394.

  3. 9095
  4. Т. Ямамура, С. Мияке, Диета, кишечная флора и рассеянный склероз: текущие исследования и перспективы на будущее, в Multiple Sclerosis Immunology (Springer, 2013).

  5. 9095

Благодарности: Мы благодарим лаборатории Карандикара, Легге, Вальдшмидта, Джаббари и Либермана за полезные обсуждения. Финансирование: Мы благодарим за финансирование Национальные институты здравоохранения / NIAID (1R01AI137075), Научно-исследовательский центр экологических наук Университета Айовы, NIEHS / NIH (P30 ES005605) и подарок от П.Хеппельманн и М. Вацек в A.K.M .; С.Н.Дж. был поддержан грантом на институциональное обучение (T32AI007485 для Г. Бишопа) и премией за разнообразие для A.K.M. на родительском 1R01AI137075. Вклад авторов: S.N.J. концептуализировал исследование, разработал и провел эксперименты и написал рукопись. N.M.C. проводил эксперименты и анализ данных. С.К.С. и S.R.P. проводил эксперименты. A.G. помог с анализом данных. K.N.G.-C выполнила патологию спинного мозга и гистологическую оценку.А.К.М. концептуализировал исследование, спланировал эксперименты и отредактировал рукопись. Все авторы прокомментировали рукопись. Конкурирующие интересы: Авторы заявляют об отсутствии конкурирующих интересов. Доступность данных и материалов: Все данные, необходимые для оценки выводов в статье, представлены в документе и / или дополнительных материалах. Дополнительные данные, относящиеся к этой статье, могут быть запрошены у авторов.

  • Copyright © 2021 Авторы, некоторые права защищены; эксклюзивный лицензиат Американской ассоциации содействия развитию науки.Нет претензий к оригинальным работам правительства США. Распространяется по некоммерческой лицензии Creative Commons Attribution 4.0 (CC BY-NC).

Какие продукты содержат много белка, но мало углеводов?

Низкоуглеводная диета с высоким содержанием белка ограничивает потребление углеводов, таких как хлеб, и способствует более высокому, чем обычно, потреблению белков, таких как постное мясо. Такой план питания может быть полезен для похудания и наращивания мышечной массы, но также может нести некоторые риски для здоровья.

Белки, углеводы и жиры являются макроэлементами. Эти питательные вещества необходимы в больших количествах, чтобы обеспечивать человека энергией и поддерживать его здоровье.

Для человека важно иметь сбалансированное питание и потреблять достаточное количество каждого макроэлемента. Однако, если человек хочет похудеть или изменить состав своего тела, он может пожелать отрегулировать баланс своих макроэлементов и потреблять больше белка, уменьшая при этом потребление углеводов.

В этой статье мы обсудим роль углеводов и белков в рационе.Мы также объясняем, какие продукты содержат много белка и мало углеводов, и предлагаем план питания, который люди могут попробовать.

Наряду с жирами, белками и углеводами входят три макроэлемента, присутствующие в пище.

Белок является основным компонентом кожи, мышц, костей, органов, волос и ногтей. Диетический белок важен для предотвращения потери безжировой массы тела, стимулирования роста и восстановления организма и в целом для поддержания хорошего здоровья. Пищевой белок может поступать из животных источников или растительной пищи.

Углеводы выступают в качестве основного источника энергии тела и могут быть простыми или сложными. Эти типы углеводов различаются по химической структуре и скорости, с которой их усваивает организм. Простые углеводы содержат одну или две молекулы сахара, и организм усваивает их быстрее, чем сложные углеводы, у которых молекулярная цепь длиннее.

Диетические рекомендации предполагают следующее потребление углеводов и белков для взрослых мужчин и женщин:

Чтобы придерживаться низкоуглеводной и высокобелковой диеты, человеку необходимо снизить потребление углеводов примерно до 26% от общего количества калорий.Определение высокого потребления белка варьируется в зависимости от источника, но одно исследование, посвященное испытанию высокобелковой диеты, определило его как 30% от общего количества потребляемых человеком калорий.

Низкоуглеводная диета с высоким содержанием белка может дать несколько преимуществ, в том числе:

  • Потеря веса: Есть некоторые свидетельства того, что низкоуглеводная диета с высоким содержанием белка может способствовать снижению веса. Этот результат частично связан с тем, что белок помогает людям чувствовать себя сытыми при меньшем количестве еды. Однако результаты будут зависеть от различных факторов, включая потребление калорий и количество упражнений.
  • Поддержание потери веса: Помимо облегчения похудания, диета с высоким содержанием белка может помочь людям поддерживать более низкую массу тела.
  • Состав тела: Состав тела означает процентное содержание жира, костей, воды и мышц в человеческом теле. Исследования показывают, что диета с высоким содержанием белка может улучшить композицию тела.
  • Сахар в крови: В исследовании 2019 года, посвященном диете с низким содержанием углеводов и высоким содержанием белка для людей с диабетом 2 типа, отмечается, что такой способ питания улучшает средний уровень глюкозы.
  • Болезни сердца: Низкоуглеводные диеты могут благотворно влиять на факторы, способствующие развитию сердечных заболеваний. Однако необходимы дополнительные исследования, чтобы установить долгосрочное влияние низкоуглеводной диеты на здоровье сердца.
  • Здоровье костей: Мета-анализ 2019 года подчеркивает, что употребление большего количества белка, чем средняя рекомендуемая суточная норма, может снизить риск перелома бедра и потери минеральной плотности костей у пожилых людей.

Принятие низкоуглеводной диеты с высоким содержанием белка может представлять определенные риски.Например, диета с высоким содержанием белка может вызвать кислотную нагрузку на почки, что может увеличить риск развития заболевания почек.

Предыдущий обзор предполагает, что длительное потребление высокобелковой диеты также может способствовать возникновению следующих проблем со здоровьем:

  • Заболевания костей
  • повышенный риск рака
  • Проблемы с функцией печени
  • Ишемическая болезнь сердца

В исследовании 2018 года отмечается, что тип белка, который человек потребляет на диете с низким содержанием углеводов и высоким содержанием белка, может влиять на смертность.Низкоуглеводные диеты, включающие в себя белок и жир из мяса, такого как курица, представляют более высокий риск смертности, чем растительные белки и жиры.

Человек должен проконсультироваться со своим врачом, прежде чем вносить какие-либо радикальные изменения в диету. Они также могут пожелать поработать с диетологом, чтобы составить план питания.

Люди, которые пытаются ограничить потребление углеводов, могут пожелать избегать следующих типов продуктов:

  • хлеб и злаки
  • крахмалы
  • сладкие напитки
  • обработанные продукты с высоким содержанием углеводов
  • злаки
  • определенные спирты
  • сок

Человек может также увеличить количество белка в своем рационе, принимая добавки, хотя рекомендуется сначала обсудить это с врачом.Белковые добавки включают:

  • Изолят сыворотки: Сыворотка является побочным продуктом молока и часто является основным ингредиентом протеиновых коктейлей. Изолят сыворотки подвергся процессу удаления жиров и углеводов, оставив в основном белок. Человек может смешать порошок изолята сыворотки с молоком или водой.
  • Порошок веганского изолята: В продуктах с порошком веганского изолята часто используется изолят гороха или фасоли. Подобно изоляту сыворотки, человек может смешивать порошок веганского изолята с молоком или водой на растительной основе.
  • Протеиновые батончики: Они часто являются полезной закуской при диете с низким содержанием углеводов и высоким содержанием белка. Тем не менее, человеку следует проверять питательные вещества, поскольку протеиновые батончики различаются по количеству углеводов и белков, которые они содержат.
  • Белковые капсулы: Это таблетки, содержащие протеиновый порошок. В зависимости от производителя в капсулах могут использоваться разные типы протеинового порошка.

Ниже приведен пример диеты с низким содержанием углеводов и высоким содержанием белка:

  • Завтрак: омлет со шпинатом или взбитый тофу
  • Закуска: полоски огурца, завернутые в кусочки курицы или хумус с морковными дубинками
  • : приправленный цыпленок-гриль или темпе с рисом из цветной капусты и овощами, такими как брокколи или запеченная в духовке морковь и цукини
  • Закуска: изолят сыворотки или веганский протеиновый коктейль
  • Ужин: индейка на гриле или веганский бургер с салатом, содержащим огурец, помидор и фета или альтернатива сыру
  • Закуска: вареное яйцо или небольшая горстка семян и орехов

Белок и углеводы являются важными макроэлементами, которые обеспечивают организм энергией и поддерживают хорошее здоровье.Диета с низким содержанием углеводов, но с высоким содержанием белка может помочь облегчить потерю веса и улучшить композицию тела.

Однако этот план питания может негативно повлиять на печень и почки, и необходимы дополнительные исследования, чтобы понять его долгосрочное влияние на здоровье. Человеку следует проконсультироваться с врачом, прежде чем кардинально изменить свой рацион.

Определение диеты Merriam-Webster

ди · эт | \ ˈDī-ət \

: продукты питания и напитки, которые предоставляются или потребляются регулярно диета из фруктов и овощей вегетарианская диета

б : привычное питание связь между диетой и болезнью

c : вид и количество пищи, прописанные человеку или животному по особой причине. был переведен на диету с низким содержанием натрия

d : режим умеренного приема пищи и питья для снижения веса. сесть на диету

2 : что-то предоставленное или неоднократно испытанное Их воображение лихорадит от диеты детективных романов… - Житель Нью-Йорка слышал постоянную диету из отговорок.

переходный глагол

1 : , чтобы заставить принимать пищу : кормить

2 : заставлять есть и пить в умеренных количествах или в соответствии с установленными правилами

непереходный глагол

: есть умеренно или в соответствии с установленными правилами сидел на диете два месяца

1 : с пониженным содержанием калорий или без них диетический безалкогольный напиток

2 : способствует снижению веса (например, подавляя аппетит) диетические таблетки

1 : формальное совещательное собрание князей или поместий.

2 : любой из различных национальных или провинциальных законодательных органов

Здоровое питание для здорового веса | Здоровый вес, питание и физическая активность

План питания, который помогает контролировать вес, включает в себя разнообразную здоровую пищу.Добавьте к своей тарелке множество цветов и представьте, что она ест радугу. Темная листовая зелень, апельсины и помидоры - даже свежие травы - богаты витаминами, клетчаткой и минералами. Добавление замороженного перца, брокколи или лука в тушеные блюда и омлеты быстро и удобно придает им цвет и питательные вещества.

Согласно рекомендациям по питанию для американцев на 2020–2025 годы pdf icon [PDF-30.6MB] внешний значок, план здорового питания:

  • Подчеркивает фрукты, овощи, цельнозерновые продукты, обезжиренное или нежирное молоко и молочные продукты
  • Включает разнообразные белковые продукты, такие как морепродукты, нежирное мясо и птица, яйца, бобовые (фасоль и горох), соевые продукты, орехи и семена.
  • С низким содержанием насыщенных жиров, трансжиров , холестерина, соли (натрия) и добавленных сахаров
  • Остается в пределах вашей дневной потребности в калориях

Значок MyPlate Planexternal Министерства сельского хозяйства США может помочь вам определить, что и сколько нужно есть из различных групп продуктов, не выходя за рамки рекомендуемой нормы калорий. Вы также можете загрузить значок в формате pdf «Мой дневник питания» [PDF-106KB], чтобы отслеживать свои приемы пищи.

Фрукты

Прекрасный выбор - свежие, замороженные или консервированные фрукты.Попробуйте не только яблоки и бананы, но и фрукты, такие как манго, ананас или киви. Когда свежие фрукты не в сезон, попробуйте их замороженные, консервированные или сушеные. Имейте в виду, что сушеные и консервированные фрукты могут содержать сахар или сиропы. Выбирайте консервированные сорта фруктов, упакованные в воду или в собственном соку.

Овощи

Добавьте разнообразия овощам, приготовленным на гриле или на пару, с добавлением таких трав, как розмарин. Вы также можете обжарить овощи на сковороде с антипригарным покрытием с небольшим количеством кулинарного спрея.Или попробуйте замороженные или консервированные овощи в качестве быстрого гарнира - просто разогрейте и подавайте. Выбирайте консервированные овощи без добавления соли, масла или сливочных соусов. Для разнообразия пробуйте новые овощи каждую неделю.

Продукты, богатые кальцием

Помимо обезжиренного и нежирного молока, рассмотрите нежирные и обезжиренные йогурты без добавления сахара. Они бывают разных вкусов и могут стать отличным заменителем десерта.

Мясо

Если по вашему любимому рецепту жарят рыбу или курицу в панировке, попробуйте более полезные для здоровья варианты, запекая или готовя на гриле.Возможно, даже попробуйте сушеные бобы вместо мяса. Спросите друзей и поищите в Интернете и журналах рецепты с меньшим количеством калорий - вы можете быть удивлены, обнаружив, что у вас есть новое любимое блюдо!

Комфорт Фудс

В основе здорового питания лежит баланс. Вы можете наслаждаться любимыми блюдами, даже если они высококалорийны, жирны или содержат сахар. Главное - есть их только время от времени и сбалансировать их более здоровой пищей и большей физической активностью.

Некоторые общие советы по приготовлению полуфабрикатов:

  • Ешьте их реже.Если вы обычно едите эти продукты каждый день, сократитесь до одного раза в неделю или один раз в месяц.
  • Ешьте меньше. Если ваша любимая высококалорийная еда - плитка шоколада, возьмите ее меньшего размера или половину плитки.
  • Попробуйте более низкокалорийный вариант. Используйте низкокалорийные ингредиенты или готовьте пищу иначе. Например, если ваш рецепт макарон и сыра включает цельное молоко, масло и жирный сыр, попробуйте приготовить его заново, добавив в него обезжиренное молоко, меньше масла, нежирный сыр, свежий шпинат и помидоры.Только помните, что нельзя увеличивать размер порции.
.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *